ID: 1024921657

View in Genome Browser
Species Human (GRCh38)
Location 7:54563509-54563531
Sequence CAGTGTCCCCAGCAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 710
Summary {0: 1, 1: 0, 2: 6, 3: 68, 4: 635}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024921654_1024921657 5 Left 1024921654 7:54563481-54563503 CCATGAAAATGTGCTGTTTTCAG 0: 1
1: 0
2: 5
3: 38
4: 539
Right 1024921657 7:54563509-54563531 CAGTGTCCCCAGCAGGAGGAAGG 0: 1
1: 0
2: 6
3: 68
4: 635

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024921657 Original CRISPR CAGTGTCCCCAGCAGGAGGA AGG Intronic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900610246 1:3541672-3541694 CACTGTCCCCAGGGAGAGGAAGG - Intronic
900899197 1:5505358-5505380 CAGTGACCCCTGCAGAAGGGAGG + Intergenic
901032407 1:6314937-6314959 CATTGTCCCGTGCGGGAGGAGGG - Intronic
901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG + Intronic
901067549 1:6501534-6501556 CAGAGTTCCCAGCAGGTGGTTGG - Intronic
901215288 1:7551572-7551594 CAGTGTCCCCAGTAGGGGAGGGG - Intronic
901429392 1:9203710-9203732 CTGTGTCCCAAGCAGGATGCGGG - Intergenic
901649812 1:10737103-10737125 CTGTGGCCCCAGCAGCTGGATGG - Intronic
901688669 1:10958838-10958860 CAATTACCCCAGCAGGAGGCCGG + Intronic
902282506 1:15384675-15384697 CAGCGTCCCCAGCTGGAGCTGGG + Intronic
902359151 1:15932613-15932635 GAGAGTCCCCAAAAGGAGGATGG + Exonic
902479419 1:16703918-16703940 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
902515264 1:16986550-16986572 CAGCGGCCCCTGCAGGAGGCCGG + Exonic
902753386 1:18533040-18533062 CAGTTTCCCCAACAGCAAGATGG - Intergenic
902782700 1:18714994-18715016 TGGGGTCCCCTGCAGGAGGAAGG + Intronic
902824428 1:18963193-18963215 CAGTTTCCCCATCAGTAAGAAGG - Intergenic
902883448 1:19388068-19388090 CAGTGTGCCTGGCAGGAGAAGGG - Intronic
903016314 1:20364403-20364425 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
903266796 1:22162712-22162734 CAGTGTCCGCAGGAAGGGGATGG + Intergenic
903266877 1:22163047-22163069 CAGTGTCCCCAGGAAGGGGATGG + Intergenic
903798629 1:25949632-25949654 CACTGCGCCCAGCATGAGGATGG + Intergenic
905217737 1:36421321-36421343 GAGTGTTCCCGGGAGGAGGATGG - Intronic
905269878 1:36780915-36780937 CAGTTTCCCCAGCTGTAGAAGGG + Intergenic
906147901 1:43570701-43570723 CTTGGTGCCCAGCAGGAGGAGGG + Intronic
906418688 1:45643953-45643975 CACTGTGCCCAGCAGGAAAATGG + Intronic
906534298 1:46543303-46543325 CAGTATCCCCAGCGGGGGGGCGG + Intergenic
907373173 1:54016066-54016088 CAGTGTCCTCAGAAGCAGAATGG + Intronic
907400884 1:54224048-54224070 CAGGGTGCCTAGCTGGAGGAAGG - Intronic
907482924 1:54757164-54757186 CTGAGGCCCCAGCAGGGGGAGGG + Exonic
907553344 1:55323454-55323476 CAGAGTCTCAAGCAGGAAGAAGG - Intergenic
907848800 1:58234553-58234575 AGGTGGGCCCAGCAGGAGGAGGG - Intronic
908596092 1:65690252-65690274 CTGTGTCTCCAACAGGAGGTGGG - Intergenic
908835130 1:68222246-68222268 CATTTCCCCAAGCAGGAGGAAGG + Intronic
910619357 1:89236091-89236113 CAGTCTCCCCAGCACCAGCAGGG + Intergenic
911934147 1:103945574-103945596 GAATGTACCCAGCAGGAGGCTGG + Intergenic
912163980 1:107020519-107020541 AAATGTCCCCTGCAGGTGGAGGG + Intergenic
913552951 1:119934860-119934882 CAATGTCCACAGCAGAATGATGG + Intronic
914444461 1:147738265-147738287 AAGTGTCCCCAGCAGCAAGGAGG - Intergenic
917533597 1:175858030-175858052 CAGTCTCCCCAGCTGAAGCAGGG - Intergenic
918072098 1:181140670-181140692 CAGTGTTCTCAGCTGGAAGATGG + Intergenic
918077796 1:181183538-181183560 CTGTGTCCTAAGAAGGAGGATGG + Intergenic
918545904 1:185683644-185683666 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
918922041 1:190725148-190725170 CTGTGTCCTCAGAAGGTGGAAGG + Intergenic
919784346 1:201249881-201249903 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
919845522 1:201639801-201639823 CCATGTCCCCAGCTGGAGGCCGG - Intronic
921039589 1:211416840-211416862 CAGGGTCCCCAGCAGGAAGGTGG - Intergenic
921815351 1:219557247-219557269 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
922745413 1:228040262-228040284 AAGTGGCCCCAACAGGAAGATGG - Intronic
922955855 1:229599064-229599086 CAGTGTCTGAAACAGGAGGAGGG + Intronic
923103191 1:230833827-230833849 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
923219477 1:231880231-231880253 CAGTGTCCCCAACAGCAAGAAGG + Intronic
923341284 1:233009033-233009055 CAGTGTGGCCAGTAGGAGCAAGG + Intronic
923545481 1:234920299-234920321 CAGTGGTGCCAGCTGGAGGAGGG - Intergenic
923556349 1:235003666-235003688 CAGAGTCCCCAACAGCAAGAAGG - Intergenic
924498560 1:244614040-244614062 CAGAGTCCCCACCAGGAAGATGG + Intronic
924646027 1:245878005-245878027 GAGTGTTCCCAGGAGGAGGAAGG + Intronic
924952519 1:248897889-248897911 CAGTCTCCCCAGCATTAGGAGGG - Intergenic
1062842176 10:680011-680033 CAGTGTCCCCAGCTGTTGAATGG - Intronic
1063192810 10:3713698-3713720 CAGTGTCTCCTGCAATAGGATGG + Intergenic
1063396399 10:5692439-5692461 CAGTAACCCCACTAGGAGGATGG - Intronic
1063441878 10:6079390-6079412 CACCCTCCCCACCAGGAGGAAGG + Intergenic
1063762250 10:9093087-9093109 CTGTGTCCTCACCTGGAGGAAGG - Intergenic
1063960862 10:11304510-11304532 CAGAGTCCCCACCAGCAAGAAGG - Intronic
1064418004 10:15167907-15167929 CAGTATCCCCAGCAGGGGCCGGG + Intronic
1064565275 10:16633192-16633214 AAGTGTCCCCAGCGGGAGTGGGG + Intronic
1065251374 10:23818504-23818526 TAGTAGCCCCAGCAAGAGGAAGG + Intronic
1065944899 10:30597344-30597366 CAGTGTAACCAGCAGGAGTTGGG + Intergenic
1065971582 10:30810128-30810150 CCGTCACCCCAGCAGGAAGATGG - Intergenic
1066347047 10:34597816-34597838 CACTGTCTCCAGAAGCAGGAGGG + Intronic
1067029651 10:42871613-42871635 CGGTGTCTCCAGCAGCAGGGAGG + Intergenic
1067465511 10:46495292-46495314 TAAAGCCCCCAGCAGGAGGAAGG + Intergenic
1067621676 10:47889309-47889331 TAAAGCCCCCAGCAGGAGGAAGG - Intergenic
1068543329 10:58320390-58320412 GAGTGTCCCCACCAGCAAGAAGG - Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1068924423 10:62520525-62520547 CAGAGTCCCCAACAGCAAGAAGG + Intronic
1069362433 10:67657947-67657969 CAGTTTGCCCAGCAGAGGGAGGG + Intronic
1069370921 10:67746935-67746957 CAGTTTCCCCAGCACCAGCAGGG - Intergenic
1069716188 10:70522933-70522955 GTGTGTGGCCAGCAGGAGGAAGG + Intronic
1070029879 10:72666720-72666742 GAGAGTCCCCACCAGCAGGAAGG - Intergenic
1070757352 10:79001641-79001663 CAGTGTCCCCAGCAGGCAGGAGG + Intergenic
1070834065 10:79436901-79436923 CAGTGACCCCAGCAGGTAGCAGG + Intronic
1071560624 10:86644591-86644613 CTGTGTCCCCAGCAGGGGACAGG - Intergenic
1072159048 10:92749427-92749449 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1072207803 10:93220570-93220592 CAGGGTCCCCACCAGCAGGAAGG + Intergenic
1072307567 10:94122049-94122071 GTGTGTCCCCAACAGGTGGAGGG - Intronic
1072610410 10:97014018-97014040 CAGTGCCCCCTGCAGTATGAGGG - Exonic
1073189690 10:101642582-101642604 CAAAGTCCTGAGCAGGAGGATGG - Intronic
1073245228 10:102085738-102085760 CATTATCCTCAGAAGGAGGAGGG + Intergenic
1073327509 10:102651150-102651172 CAGTGGCCTCAGCAGCAGGAGGG + Intronic
1074077659 10:110143340-110143362 CAGTGTGCCCAGGTGGAGAAGGG - Intergenic
1074106013 10:110390179-110390201 CAGGTCCCCCAGCAGCAGGAGGG - Intergenic
1075398775 10:122146609-122146631 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1076423693 10:130352158-130352180 CAGTGTCCCAGGCAGGAGCCTGG + Intergenic
1076468873 10:130704644-130704666 CAGAGTCCCCGCCAGCAGGAAGG + Intergenic
1076517636 10:131057126-131057148 CACCCTCCCCAGCAGCAGGAGGG + Intergenic
1076650274 10:131982355-131982377 CAGTTTCCCCACTAGCAGGATGG - Intergenic
1076686219 10:132199602-132199624 CAGTGCGGACAGCAGGAGGAGGG - Intronic
1076729400 10:132430977-132430999 CAGGGTCCCGAGAAGGAAGATGG + Intergenic
1076930219 10:133527439-133527461 CATGGACACCAGCAGGAGGAAGG - Exonic
1077498353 11:2897480-2897502 CAGTGCCCACAGCAGGCTGAAGG + Intronic
1078521730 11:12069126-12069148 CACTGTGCCCAGCTGGAAGAGGG - Intergenic
1078662239 11:13296916-13296938 CACTGTCACAGGCAGGAGGACGG - Intronic
1079043573 11:17080245-17080267 CAGTGCCAACAGCAAGAGGAAGG - Intronic
1079384284 11:19965156-19965178 CTGTGTCCTCAACAGGAGAATGG - Intronic
1079960111 11:26913598-26913620 CAGAGTCCCCATCAGCAAGAAGG + Intergenic
1080120064 11:28666866-28666888 CAGTGAGCACAGCAGGAGGGAGG + Intergenic
1080381569 11:31777266-31777288 CAGGGTCACAAGGAGGAGGATGG - Intronic
1080802524 11:35620468-35620490 CACTGTTCCAAGCAGGGGGACGG + Exonic
1081412964 11:42781772-42781794 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1081493195 11:43582452-43582474 CAGTGTTCCTAGCAGGCGAAGGG - Intronic
1081993654 11:47350565-47350587 CAGTGGCCTCAGCAGGGGCAGGG + Exonic
1082772261 11:57217205-57217227 CTGCTTCCCCAGGAGGAGGAAGG - Intergenic
1082796331 11:57380664-57380686 AACTGTTCCCAGCAGGAGAAAGG + Exonic
1082872779 11:57958895-57958917 GAGTGTCCCCATCAGCAAGAAGG + Intergenic
1083181119 11:60986307-60986329 CAGTCTCACCAGCAGGAAGGTGG + Intronic
1083222504 11:61262276-61262298 CAGTTTCCCCAGGTGGAGGTAGG + Intronic
1083236865 11:61356666-61356688 CAGGGACCCCAGCAGCAGGCAGG + Exonic
1083800683 11:65044711-65044733 CTGGGTCCCCAGCCTGAGGAGGG + Exonic
1083882501 11:65555456-65555478 CAGTGTCTCCACCAGGAGGGAGG + Intronic
1084497974 11:69516342-69516364 GAGAGTCCCCAGCAGCAAGAAGG + Intergenic
1084683567 11:70680842-70680864 GAGAGTCCCCACAAGGAGGACGG - Intronic
1084713818 11:70860998-70861020 CCGTGTGCCCAGCAGGTCGAGGG - Intronic
1084755495 11:71235954-71235976 CAGTTTTCTCAGCAGGAGAATGG - Intronic
1084794846 11:71498185-71498207 CAGTGTCCCCGGCCTGAGCACGG + Intronic
1085203275 11:74714540-74714562 CAGTGACCCCAGAAGGCGTAGGG - Intronic
1085297196 11:75437910-75437932 CCCTGTCCCCACCAGGAGGAGGG + Intronic
1085299427 11:75449713-75449735 CAGTGTCCCCAGTTGGCAGATGG - Intronic
1085309963 11:75510385-75510407 CAGTGTCCCCAGCACCTGGCTGG - Intronic
1086570777 11:88281751-88281773 CCCTGTCTCCACCAGGAGGAAGG + Intergenic
1089376756 11:118000059-118000081 CAGAGCTTCCAGCAGGAGGAAGG + Exonic
1089583524 11:119496047-119496069 CAGAGACTCCAGGAGGAGGAGGG - Intergenic
1089608080 11:119653416-119653438 CAGTGTCCCCTGCAGGAGGGTGG + Intronic
1090033009 11:123223459-123223481 CAGGGTCCCCATCAGCAAGAGGG + Intergenic
1090283384 11:125477781-125477803 CAGTGTCCCCTGGAGGCAGAAGG - Intronic
1091428417 12:411780-411802 CAGTGGTCCCACCAAGAGGAGGG + Exonic
1091838823 12:3604826-3604848 CTGTGGCCCAGGCAGGAGGAGGG - Intergenic
1092273831 12:7044210-7044232 CAGTGTGCACAGCAGCAGGGAGG - Intronic
1092461146 12:8687417-8687439 AAGTGACCACAGAAGGAGGATGG - Intronic
1092826361 12:12403486-12403508 CAGTTTCCTCAGAAGCAGGAAGG - Intronic
1093573415 12:20695751-20695773 CAATGTGCTCAGCAAGAGGATGG - Exonic
1094649268 12:32359384-32359406 CAGAGTCCCCACCAGCAAGAAGG - Intronic
1096048606 12:48586516-48586538 CAGTGTCTCCTGGAGGGGGATGG - Intergenic
1096589693 12:52649359-52649381 CAGTGTCTCAAGCAGGAGAGAGG - Intronic
1096957939 12:55546071-55546093 CAGGGTCCCCAAGAGTAGGAAGG - Intergenic
1097996082 12:65888990-65889012 CTGTGTCCACACTAGGAGGAAGG + Intronic
1098833102 12:75387659-75387681 CAGAGTCCCCAGTAGCAAGAAGG - Intronic
1099904321 12:88754021-88754043 CAGAGGCCACAGGAGGAGGATGG + Intergenic
1099968415 12:89475412-89475434 CAGTGACCAGAGCAGGGGGAAGG - Intronic
1100583199 12:95955722-95955744 TAGCGTCACCAGCTGGAGGATGG + Intronic
1101570821 12:105952040-105952062 ATGTTCCCCCAGCAGGAGGAAGG - Intergenic
1101940292 12:109094833-109094855 CAGAGTCCCCACCAGCAAGAGGG + Intergenic
1101991103 12:109485854-109485876 CAGTGTCCTCATCTGTAGGAAGG + Intronic
1102259707 12:111436576-111436598 CAGAGTCCCCAGCAGCAACATGG - Intronic
1103671031 12:122615580-122615602 CAGTGTCCCCAGCAGTCACAAGG - Intronic
1104071535 12:125350084-125350106 CAGTGTCCTCTGGAGGAGGAAGG + Exonic
1104110784 12:125702262-125702284 CTGTGTCCCCACCAGGTGGAGGG + Intergenic
1104131411 12:125897874-125897896 CACTGTCCTCAGCAGGAGTGTGG + Intergenic
1104477757 12:129084492-129084514 CATCGTCTCCAGCAGGAGGTGGG - Exonic
1104512159 12:129390692-129390714 CAGAGTCACCAGCAAGAAGAAGG - Intronic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1104967053 12:132513022-132513044 CAGTGTCCCCACCAGGGCGCGGG - Intronic
1104980331 12:132570625-132570647 CAGAGACCACAGCAGGTGGAGGG - Intronic
1105788155 13:23769985-23770007 CGGCGTCCCCACCAGCAGGAGGG + Intronic
1105793969 13:23832281-23832303 CAGAGTCCCCACCAGTAGGAAGG + Intronic
1105801068 13:23903677-23903699 AGGTGTCCCCAGCGGGAGGTCGG - Intergenic
1105847799 13:24308268-24308290 GGGTGTCCCCAGCAGGAGGTCGG + Intronic
1106099136 13:26679339-26679361 AAGGGTGCCCATCAGGAGGACGG - Intronic
1106884445 13:34168921-34168943 CAATGTCCTCACAAGGAGGAAGG + Intergenic
1107440478 13:40422980-40423002 CAGACTCCCCAGAGGGAGGAGGG - Intergenic
1108172484 13:47756131-47756153 CACTGTCCCCAGTAGGGGAAAGG - Intergenic
1108458731 13:50643725-50643747 GAGAGTCCCCACCAGCAGGAAGG - Intronic
1108596582 13:51955080-51955102 AAGTGTCCCCAGCAAAGGGATGG + Intronic
1108896382 13:55334276-55334298 CAGTGTCCCAAGGCTGAGGAGGG - Intergenic
1109219407 13:59626072-59626094 CAGTGTCCCCATGAGGATGCTGG - Intergenic
1109838567 13:67891832-67891854 CAGAGTCCCTAGCAATAGGATGG + Intergenic
1109892377 13:68632002-68632024 CAGAGTCCCCACCAAGAAGAAGG - Intergenic
1110870798 13:80450547-80450569 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1111679133 13:91422715-91422737 CAGAGTCCCCACCAGCAGGAAGG - Intronic
1113267220 13:108633062-108633084 CATTGTTTGCAGCAGGAGGAAGG + Intronic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1113762532 13:112859574-112859596 CAGGGTGCCCAGCAGCAGGCGGG + Intronic
1114051482 14:18922050-18922072 CTCAGTCACCAGCAGGAGGAGGG - Intergenic
1114111079 14:19479874-19479896 CTCAGTCACCAGCAGGAGGAGGG + Intergenic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1114655008 14:24310738-24310760 CAGCGCCGCCAGCAGCAGGAAGG - Exonic
1115305487 14:31929747-31929769 CAGTGTTACCAGCAGGATTAAGG - Intergenic
1116194302 14:41702702-41702724 GAGAGGCCCAAGCAGGAGGATGG - Intronic
1118758908 14:68865883-68865905 GAGTGACCCCAGCTGGAGGCAGG - Intergenic
1119323735 14:73746430-73746452 CAGGGATCCCAGCAGGAGTAGGG + Intronic
1119536433 14:75406562-75406584 CAGAGTCCCCAACAGCAAGAAGG - Intergenic
1120887392 14:89462571-89462593 CAGAGTCCCCATCAGGAAGAAGG - Intronic
1121000228 14:90446582-90446604 CACTGGTCCCAGCAGGAGGCGGG + Intergenic
1121142389 14:91554946-91554968 CAGTCTCCCCAGCACCAGCAGGG - Intergenic
1121419392 14:93802010-93802032 CAGTGTCCTCATCAGAAGGCTGG - Intergenic
1121526251 14:94621450-94621472 CTGAGTCCCCTGAAGGAGGAAGG - Intronic
1121786479 14:96665277-96665299 GAGGGTCCCCAGCAGCATGAAGG + Intergenic
1121900136 14:97686409-97686431 CAGAGTTCCCAGCAGCAAGAAGG - Intergenic
1122275523 14:100588970-100588992 TAGTCTCCCCAGCAGGAGTAGGG + Intergenic
1122722558 14:103730434-103730456 CAGGCTCCCCAGGAGGAGGCAGG - Intronic
1122816619 14:104317126-104317148 CAGGGGCCCCAGCTGCAGGATGG - Intergenic
1122863104 14:104591377-104591399 CTGTGTCCCCAGCAGAAGGTGGG - Intronic
1123042822 14:105497349-105497371 CAGAGTCCGCAGCAGCTGGAAGG - Exonic
1123793987 15:23753384-23753406 CAGTGTGCAGAGCAGGAGGAGGG + Intergenic
1124488841 15:30141593-30141615 CAGTGTCCCCATCAGGAAAGAGG + Intronic
1124543924 15:30610557-30610579 CAGTGTCCCCATCAGGAAAGAGG + Intronic
1124686360 15:31786128-31786150 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1125500898 15:40239873-40239895 TGCTGTCCCCAGCAGGGGGACGG - Intronic
1125532813 15:40424579-40424601 CAGTTTCCCCAGCATTAGGCAGG + Intronic
1126363535 15:47870763-47870785 GGTTGTGCCCAGCAGGAGGAGGG - Intergenic
1127495365 15:59506270-59506292 CAGCCTCCCAAGCAGCAGGAGGG + Intronic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128756703 15:70188193-70188215 CAGTTTCCCCATCAGTAGAATGG + Intergenic
1129461046 15:75700268-75700290 CAATGGCCCCAGTGGGAGGAGGG + Intronic
1129519236 15:76175702-76175724 CAGTGTCCCCAGCAAGACCACGG - Intronic
1129608389 15:77035756-77035778 CAGTGTCCCCAGAAGGGGAGGGG + Intronic
1129723774 15:77891457-77891479 CAATGGCCCCAGTGGGAGGAGGG - Intergenic
1129757191 15:78105557-78105579 CTTTGTCCCCTGCAGGGGGAAGG - Intronic
1129828262 15:78650034-78650056 GAGTGTGCCCAGGAGGAGGATGG + Intronic
1129876999 15:78982116-78982138 CAGTGTCCCCATCTGGAAAATGG + Intronic
1129990235 15:79955570-79955592 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1130557570 15:84933555-84933577 CAGAATCCCCAGCAGCAAGAAGG - Intronic
1130829682 15:87586671-87586693 CAGTGCTCCCAGCAGCAAGAAGG + Intergenic
1130949413 15:88573687-88573709 CAGTGCCCTCAGCAGCAGCATGG + Intergenic
1131086481 15:89579806-89579828 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1131781710 15:95866724-95866746 CTGTGGACCAAGCAGGAGGAAGG + Intergenic
1132462978 16:64536-64558 CAGTATCCAGAACAGGAGGAGGG + Intronic
1132558786 16:584232-584254 CAGGGCCTCCAGCAGGAGGCCGG - Intergenic
1132949038 16:2550094-2550116 CAGTGTCCCCATCTGTAGAAAGG + Intronic
1132965550 16:2652033-2652055 CAGTGTCCCCATCTGTAGAAAGG - Intergenic
1133267340 16:4593122-4593144 AAGCCTTCCCAGCAGGAGGAAGG - Intronic
1133423737 16:5669295-5669317 CAGCCTACCCAGCAGCAGGAGGG + Intergenic
1133431379 16:5739989-5740011 CAGTGTGGCCAGCAGTGGGAGGG + Intergenic
1133770338 16:8863945-8863967 GAGTGTCCCCAGCAGAAGACAGG + Intronic
1134809058 16:17151519-17151541 CAGTGTCCCCATCTGGAAAATGG + Intronic
1135114070 16:19711176-19711198 AAGGGCCCCCAGCATGAGGATGG + Intronic
1135214087 16:20549363-20549385 CAGAGTCCCCATCAGCAAGAAGG - Intronic
1135494772 16:22941795-22941817 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1135597407 16:23754946-23754968 CAGTGGCCCCAGGGGGACGAAGG - Exonic
1136009841 16:27356411-27356433 CAGTCTCCCCAGTAGGATGCCGG - Intronic
1136055162 16:27682955-27682977 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1137707707 16:50547501-50547523 CAGTGTCCCCAGAAGGGGGCAGG + Intergenic
1137730311 16:50684646-50684668 CTGTGTCCCCCGCATGACGATGG - Intergenic
1138323650 16:56142033-56142055 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1138445170 16:57059004-57059026 CAGTGTCTCCAGCAGGTACAGGG - Exonic
1139289997 16:65849447-65849469 CAGTGACCCCTCCAGGAGCAAGG + Intergenic
1139300777 16:65943552-65943574 CATTTTCTCCAGCATGAGGAGGG - Intergenic
1140388196 16:74561148-74561170 CTCTGACACCAGCAGGAGGAAGG - Intronic
1141096381 16:81165895-81165917 CAGTTTTCCCAGCAGGAGGGTGG + Intergenic
1141191178 16:81825777-81825799 CAGAGTCTCCAGCATGTGGAGGG - Intronic
1141642516 16:85349522-85349544 GAGTGTCCCCAGCAGGGGCAGGG + Intergenic
1141863763 16:86735820-86735842 GAGAGTCCCCACCAGCAGGAAGG - Intergenic
1141863786 16:86735929-86735951 CAGAGTCCCCACCAACAGGAAGG - Intergenic
1141883869 16:86878693-86878715 CTGTGTCCCAAGCAGGAGGCAGG - Intergenic
1142075574 16:88115723-88115745 CAGAGCCCCCAGAAGGAGTACGG - Intronic
1142107785 16:88315602-88315624 CTGTGACCCCAGAAGGAGGGTGG + Intergenic
1142108380 16:88318333-88318355 CAGCGTCTCCAGGAGGAGGCTGG - Intergenic
1142113329 16:88343605-88343627 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1142129439 16:88426003-88426025 CTCTGTCCCCAGCACGAGGTTGG - Intergenic
1142186770 16:88698433-88698455 GAGGGGCCCGAGCAGGAGGAGGG + Intronic
1142204084 16:88774518-88774540 CAGAGTCCCCAGCAGCAGCCTGG + Intronic
1142420495 16:89966718-89966740 CTGTGGCCCCAGCCTGAGGAGGG + Exonic
1142887546 17:2922192-2922214 CAGTGTCCTCACAGGGAGGAAGG + Intronic
1143350512 17:6284751-6284773 CAGCGTCCCCAGCAGAGGGGAGG + Intergenic
1143543317 17:7582260-7582282 CAGTGGCCCCAAGAGGAGGAAGG - Intergenic
1143604818 17:7976757-7976779 CAGGGACTCCTGCAGGAGGAAGG + Intergenic
1143619503 17:8072997-8073019 CAGGGCCACCGGCAGGAGGAGGG - Intronic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144344393 17:14336935-14336957 CAGAGTCCCCACCAGCAAGAAGG - Intronic
1144711644 17:17405209-17405231 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1144774145 17:17776163-17776185 CAGTTTCCCCCTCAGTAGGATGG - Intronic
1144807516 17:17977671-17977693 CAGGGCCCCCAGGAGGAGGCCGG + Exonic
1145056054 17:19704739-19704761 CAGCGTCCCCAGCAGGGCCATGG - Intronic
1145263676 17:21369239-21369261 CAGTCTCCTCAGCTGTAGGATGG - Intergenic
1145351462 17:22088489-22088511 CTCTGGCACCAGCAGGAGGAGGG + Intergenic
1145751138 17:27355894-27355916 CAGTGTCCAAAGCAGGTGCAAGG - Intergenic
1145993535 17:29093092-29093114 CAGTGTCCCCATAAGGATGCTGG + Intronic
1146125881 17:30231134-30231156 CAGTTTCCCCAGCATGAAAATGG + Intronic
1146769666 17:35556963-35556985 CATTGTCCCCATCAGCAGGGAGG - Intronic
1146884008 17:36458993-36459015 CAGTGTCCCCAGCTAGAAAAAGG - Intergenic
1146957360 17:36943251-36943273 CGGTCTCCCCAGAAGGAGAATGG - Exonic
1148598770 17:48878262-48878284 CAGAGCCCTCAGCAGGAAGAGGG + Intergenic
1148663647 17:49358125-49358147 CAGTTTCCTCAGCAGCAGAATGG - Intronic
1149601787 17:57898197-57898219 CTGCATCCCCAGCAGGAGGCAGG - Intronic
1149632647 17:58139638-58139660 CAGAGTCCCCAACAGCAAGAAGG - Intergenic
1149680385 17:58503015-58503037 ATGGGTTCCCAGCAGGAGGATGG - Intronic
1149991674 17:61387084-61387106 CAGGGGCCCCAGCAGTAGGTCGG - Intronic
1150849300 17:68689209-68689231 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1151231747 17:72690065-72690087 CACGCTCCCCAGAAGGAGGAAGG - Intronic
1151286367 17:73114455-73114477 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1151345976 17:73501418-73501440 CAGTGTCCACACCTTGAGGAGGG + Intronic
1151376402 17:73691724-73691746 CAGTGACCCCAGCGGCAGAAGGG + Intergenic
1151459840 17:74248083-74248105 CAGTGGCTCCTGAAGGAGGACGG + Intronic
1151476356 17:74346233-74346255 CAGTGGCCTTGGCAGGAGGACGG + Intronic
1151827169 17:76529944-76529966 CAGTGTGGTCAGCAGCAGGAAGG + Intronic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1152089566 17:78239248-78239270 CTGAGTCCCCAGCAGGTGGGAGG + Exonic
1152367467 17:79864881-79864903 CAGAGGCCACAGCAGGAGGAGGG - Intergenic
1152387686 17:79984902-79984924 CTGTGTCCGAAGCTGGAGGATGG - Intronic
1152438274 17:80289133-80289155 CAGTGCCCCCAGGAGGAGTTGGG + Intronic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1153185086 18:2477499-2477521 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1153725041 18:7945485-7945507 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1153916853 18:9753439-9753461 CAGAGTCCTCACCAGCAGGAAGG + Intronic
1153979389 18:10296420-10296442 CGGTGTCAGCAGCAGGAGAAAGG - Intergenic
1154282723 18:13020468-13020490 AAGTGTCCACAGAAGGATGAGGG - Intronic
1155853044 18:30796536-30796558 GAGAGTCCCCACCAGGAAGAAGG - Intergenic
1156037259 18:32778930-32778952 CAATGTCCCCAGCGGGAAAAGGG - Intergenic
1157023724 18:43817448-43817470 CAGAGTCCCCATCAGCAAGAAGG + Intergenic
1157401864 18:47395453-47395475 CTGTGTTCCCAGCAGGAGGAAGG + Intergenic
1157558884 18:48632344-48632366 CACAACCCCCAGCAGGAGGAGGG - Intronic
1157872907 18:51246801-51246823 CAGAGTCCTCATCAGCAGGAAGG + Intergenic
1159564260 18:70031359-70031381 ATGTGTCCCCAGAAGGAGAAAGG - Intronic
1160055566 18:75476593-75476615 GCCTGTCCCCAGCAGGATGAAGG - Intergenic
1160511874 18:79457429-79457451 CAGTCCCCACTGCAGGAGGAGGG + Intronic
1160738845 19:676807-676829 CAGTTTCCCCATCTGGAAGACGG - Intronic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1160763164 19:795934-795956 CAGTTTCCCCAGCCGTAGGCTGG + Intergenic
1160763191 19:796039-796061 CAGTTTCCCCAGCTGTAGGCGGG + Intergenic
1160763287 19:796438-796460 CAGTTTCCCCAGCTGTAGGCGGG + Intergenic
1160763325 19:796592-796614 CAGTTTCCCCAGCTGTAGGCGGG + Intergenic
1160763338 19:796644-796666 CAGTTTCCCCAGCTGTAGGCGGG + Intergenic
1160935792 19:1593850-1593872 CAGTTTCTCCAGCTGGAGGCAGG - Intergenic
1160954582 19:1684643-1684665 CAGGGTCTCAAGCAGGGGGAGGG + Intergenic
1161168543 19:2801717-2801739 CAGAGTCCCCACCAGGAAGAAGG - Intronic
1161331580 19:3690959-3690981 GAGTGTCCCCACCAGGGAGACGG - Intronic
1161373756 19:3928369-3928391 CAGTGTCCCCACTGGGTGGATGG - Intergenic
1161383196 19:3977328-3977350 CAGTGTCCAGAGCAGGTGGTCGG - Exonic
1161394059 19:4035363-4035385 CAGTCTCCCCACCCGCAGGAAGG - Intronic
1161675763 19:5647795-5647817 CAGTCTCCCCTGCAGGAGCCTGG - Intronic
1161854960 19:6759022-6759044 CTGTGTGACCAGCATGAGGAGGG + Intronic
1162678903 19:12323552-12323574 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1162685991 19:12384816-12384838 TAGAGTCCCCACCAGCAGGAAGG + Intronic
1162686883 19:12394258-12394280 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1162691230 19:12434040-12434062 CAGAGTCCCCATCAGCAAGAAGG + Intronic
1162916011 19:13874802-13874824 CAGAGTCACCGGCAGGAGGATGG - Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163287378 19:16357216-16357238 CAGTGTCCCCAGCTGTCAGAGGG - Intronic
1163316607 19:16544728-16544750 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1163510885 19:17734259-17734281 CAGGGTCACCTGCAGGTGGAGGG - Exonic
1163837164 19:19582001-19582023 GGGTGGCCCCAGCAGGAGGCTGG + Intronic
1164399043 19:27890333-27890355 CTGTGTCCCCAGCAGGAATGAGG + Intergenic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164549931 19:29201437-29201459 GAGAGTCCCCAGCAGCAAGAAGG + Intergenic
1164561700 19:29296800-29296822 CAGCCTCCTCAGCAGAAGGAGGG + Intergenic
1164630013 19:29755913-29755935 ATGTGTCCTCAGCAGCAGGAGGG - Intergenic
1165486846 19:36101561-36101583 CAGTTTCCCCATCTGGAGGAGGG - Intronic
1165526420 19:36359015-36359037 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1165912130 19:39236102-39236124 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1165963061 19:39551536-39551558 CAGTGTTCCCAGCTGGAGTGTGG - Intergenic
1166007373 19:39916678-39916700 CAGTTTCCCCATCAGTAAGATGG + Intronic
1166159052 19:40938076-40938098 CACTGGCCCCAGCTGGAGGGAGG - Intergenic
1166785051 19:45362675-45362697 CTGTGTCCCCAGCATGAAGCAGG + Intronic
1167360529 19:49028135-49028157 CAGGAGCCACAGCAGGAGGATGG - Intronic
1167363119 19:49040665-49040687 CAGGAGCCACAGCAGGAGGATGG + Intergenic
1167365448 19:49052921-49052943 CAGGAGCCACAGCAGGAGGATGG - Intergenic
1167719496 19:51168657-51168679 CAGAGTCCCCATCTGGAGGCTGG + Intergenic
1168309397 19:55452898-55452920 CGGGGTCCCCAGCAGGTGGGGGG - Intergenic
1168351426 19:55678340-55678362 CAGGGGCCCCAGCAGGAAGGAGG + Intronic
1202713458 1_KI270714v1_random:29824-29846 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
924980815 2:219454-219476 CTGTGTCCTCACAAGGAGGAAGG - Intronic
925018931 2:553581-553603 CTGTGTTCCCAGGAGGAGGTCGG + Intergenic
925018979 2:553711-553733 CTGTGCCCCCAGGAGGAGGTGGG + Intergenic
925018993 2:553742-553764 CTGTGCCCCCAGGAGGAGGTGGG + Intergenic
925019004 2:553772-553794 CTGTGCCCCCAGGAGGAGGTGGG + Intergenic
925038090 2:707208-707230 CAGTGACCCCAGGAGAGGGAGGG - Intergenic
925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG + Intergenic
925909461 2:8564140-8564162 GAGTGTCCCCACCAGGCAGAGGG - Intergenic
926006527 2:9377343-9377365 CAGTGTCCTGAGCAGTAGGGAGG + Intronic
926124136 2:10261356-10261378 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
926172195 2:10559350-10559372 CACTGTCCCGGGCAGCAGGATGG - Intergenic
926186550 2:10695343-10695365 CAGAGTCCCCATCAGCAAGAAGG + Intergenic
926195916 2:10763461-10763483 GTGTGTCCCCAGCAGGGTGATGG + Intronic
926233182 2:11020201-11020223 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
926629028 2:15120000-15120022 CAGTGACCCCGGCAGGTGGACGG + Intergenic
926712813 2:15896249-15896271 CAGTTTCCCCAGCTGCAGGTTGG - Intergenic
927747031 2:25632668-25632690 GAGAGTCCCCAGCAGCAAGATGG + Intronic
927758176 2:25725483-25725505 CAGTGGTCTCAGGAGGAGGAAGG - Intergenic
927971306 2:27307599-27307621 CAGGGTCCGCAGCAGGTGAAAGG + Exonic
928035822 2:27822180-27822202 CAGTCTTCCCAGCAGGACTATGG + Intronic
930000740 2:46859983-46860005 CAGTGACCCCAGAAGGAGGAAGG + Intergenic
930028987 2:47046993-47047015 CAGGGTCTCCAGCAGGAGACAGG - Intronic
930256725 2:49101835-49101857 CAGAGTCCCCACCAGCAAGAAGG - Intronic
930271608 2:49263848-49263870 CAGTGTGCCTAGCAGGATGCTGG - Intergenic
931134227 2:59378186-59378208 CACTGTCCCCATCAGCAGCAGGG + Intergenic
931248628 2:60511183-60511205 CAGTGCCCCTGCCAGGAGGAGGG - Intronic
931447225 2:62336716-62336738 CATTGTGGCCATCAGGAGGACGG - Intergenic
931631747 2:64308246-64308268 CAGACTCCCAGGCAGGAGGAGGG - Intergenic
932117907 2:69069835-69069857 AAAAGACCCCAGCAGGAGGAAGG + Intronic
932166610 2:69513610-69513632 CACTGTGCCCAGCAGAAAGATGG + Intronic
932637731 2:73407116-73407138 CAGAGTCCCCATCAGCAAGAAGG - Intronic
934166396 2:89297904-89297926 CAGTGTCCCAAGTCAGAGGAGGG + Intergenic
934200880 2:89884552-89884574 CAGTGTCCCAAGTCAGAGGAGGG - Intergenic
935331105 2:101978716-101978738 CAGTGCCCACAGCAGAAAGAGGG - Intergenic
935743370 2:106170308-106170330 CAGTGTCTCCTGGAGCAGGAGGG - Intronic
936012801 2:108935994-108936016 CAGTGCCCACTGCAGGAAGAAGG + Intronic
936078361 2:109416029-109416051 CAGAGTCCCCACCAGCAAGAAGG + Intronic
937921742 2:127136299-127136321 GAGAGTCCCCAGCAGCATGAAGG + Intergenic
938816369 2:134908678-134908700 CAGAGTCCCCACCAGTAAGAAGG - Intergenic
938918424 2:135968459-135968481 CAGAGTCCCCACCAGCAAGAAGG - Intronic
940043852 2:149388898-149388920 CAATGTGCCCAGCATTAGGAAGG - Intronic
940098971 2:150011566-150011588 AAGTGTCCAGAACAGGAGGAGGG - Intergenic
941125628 2:161580221-161580243 CAGTGTCCCCAGAAGCTGGTGGG - Intronic
943635685 2:190304337-190304359 CAGAGTCCCCACCAGTAAGAAGG - Intronic
943851099 2:192724090-192724112 CAGAGTCCCCACCAGGAAGAAGG - Intergenic
944408226 2:199409813-199409835 CATTATCCCCTGCAGTAGGAAGG - Intronic
944874676 2:203950245-203950267 GAGTGTCCCCACCAGAAAGAAGG - Intronic
945158173 2:206860926-206860948 GAGTGTCCCCACCAGCAAGAAGG + Intergenic
946219153 2:218211537-218211559 AAGGAGCCCCAGCAGGAGGAAGG - Intergenic
946227709 2:218273032-218273054 CAGTGTTCCCAGCTGGATGGTGG + Intronic
947731374 2:232433374-232433396 CAGTGTGCCCAGGAGGAGAGGGG + Intergenic
947844910 2:233236238-233236260 AAGGGCCCCTAGCAGGAGGAGGG - Intronic
948219675 2:236259682-236259704 CAGTGAGCCCAGCAGGATGTTGG + Intronic
948468980 2:238165439-238165461 CCGAGTCCCCAAGAGGAGGAAGG - Intronic
948489396 2:238302849-238302871 CAGAGTCCTGAGCAGGAGCAGGG - Intergenic
948726338 2:239936305-239936327 CAGTGTCCCCAGGCAGAGAATGG + Intronic
949039837 2:241843131-241843153 CCGTGTCCACCGCCGGAGGAAGG - Intergenic
1168813279 20:720116-720138 CAGAGTCTCCAGCTGGAGGTTGG + Intergenic
1169907155 20:10615837-10615859 CAGTGTCCCCACAAAGTGGAAGG + Intronic
1170118707 20:12889032-12889054 CTGTGTCCCCAGCAGAGTGATGG + Intergenic
1171037353 20:21726340-21726362 CAGAGTCACCACCAGCAGGAAGG - Intergenic
1171060775 20:21957082-21957104 CAGTGTCAGCAGCTGTAGGAAGG + Intergenic
1171451227 20:25237477-25237499 CAGTCTTCCCAGGAGGAGGCCGG - Intergenic
1171966265 20:31533161-31533183 CAGTGCCCCAACCAGGAGGAGGG - Intronic
1172047973 20:32094321-32094343 AAATGTCCATAGCAGGAGGATGG + Intronic
1172563959 20:35913579-35913601 CAGTGTGCCCTGCTGCAGGATGG + Intronic
1172768684 20:37364441-37364463 CAGGGGCCCCACAAGGAGGAGGG - Intronic
1173443308 20:43096512-43096534 CAGGAGCCCCAGGAGGAGGAGGG - Intronic
1173554256 20:43954418-43954440 CAGAGTCCACTGCAGGAGGCAGG - Intronic
1173648637 20:44649500-44649522 CAGTGTCCACACCTGGAGGATGG - Intronic
1173786522 20:45797246-45797268 CAGTTTTCCCAGCAGGATCATGG - Intronic
1173890904 20:46509473-46509495 AAGTTTCCTCAGCAGGAGCATGG + Intronic
1174220863 20:48954111-48954133 CAGTGTCCACAGGAGGACAAGGG + Intronic
1174393603 20:50233049-50233071 CTCTGTCCCCTGCAGGAGGCAGG - Intergenic
1174398848 20:50264937-50264959 CCGGATCCCCAGCGGGAGGAGGG + Intergenic
1174753542 20:53136073-53136095 GAGTGTCCCCACCAGCAAGAAGG - Intronic
1175212977 20:57373075-57373097 CTGCCTCCCCAGCTGGAGGAGGG - Intronic
1176179400 20:63742321-63742343 CTGTGTCTCCCGCAGGAGGCAGG + Exonic
1177110831 21:17026339-17026361 CAATGTCCCAGGCAGGAAGATGG + Intergenic
1177666104 21:24161719-24161741 CAGAGTCCCCATCAGGAAGAAGG + Intergenic
1178901952 21:36605600-36605622 CAGTGGCCCCAGCTGGAGCCAGG + Intergenic
1179651927 21:42816742-42816764 GAGAGTCCCCACCAGCAGGAAGG - Intergenic
1179879368 21:44287048-44287070 CAGACTCCCCACCAAGAGGAAGG + Exonic
1180213286 21:46308924-46308946 CAGAGTCCCCAACAGCAAGAAGG + Intronic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1180237105 21:46469337-46469359 CAGTGAACCCATCAGCAGGATGG + Intronic
1180469955 22:15644426-15644448 CTCAGTCACCAGCAGGAGGAGGG - Intergenic
1181035875 22:20169535-20169557 CAGTGACCACAGGACGAGGAGGG - Intergenic
1181173393 22:21022773-21022795 CAGTGCCCCCAGCAGGGTGGGGG + Intronic
1181684093 22:24516579-24516601 CAGTGTCCCCAGCAGGACAGGGG + Intronic
1181749003 22:24976132-24976154 CAGTGTTCCCAGCTGCAGCAGGG - Intronic
1181916070 22:26281290-26281312 GATAGTCCCCACCAGGAGGAAGG + Intronic
1182080418 22:27524814-27524836 CAGTGTCCCCATCTGTAGGATGG - Intergenic
1182314263 22:29433456-29433478 CAGTTTTCCCAGCAGGAGATGGG - Intergenic
1182538231 22:31022241-31022263 CAGAGTCCCCAACAGCAAGAAGG - Intergenic
1182547836 22:31085849-31085871 CAGTGTCCCCATCTGGAAAATGG - Intronic
1183027781 22:35078951-35078973 CAGTCTCCCCATCAGTAGAATGG - Intronic
1183124334 22:35761230-35761252 CAGTGCCCCTATCAGGAAGAGGG - Exonic
1183457560 22:37930888-37930910 CAGAGTCCCCAGCGGGGAGAGGG + Intronic
1183664301 22:39238555-39238577 CAGTGTTCTCATCTGGAGGATGG - Intronic
1184080100 22:42213320-42213342 CAGAGCCTCCAGGAGGAGGAGGG - Exonic
1184093021 22:42302196-42302218 CAGTTTCCCCATCTGGAGAAGGG - Intronic
1184451405 22:44584868-44584890 CAGTTTCCCCATCTGTAGGAGGG - Intergenic
1184473995 22:44710953-44710975 CAGTGTCCCCATCTGGAAAATGG - Intronic
1184695057 22:46134318-46134340 CATTGCCCTCTGCAGGAGGAGGG - Intergenic
1184783137 22:46658967-46658989 CAGTGCCGCCAGCAGGAAGCAGG + Intronic
1185161756 22:49234214-49234236 TAATGTCCCCACCACGAGGATGG + Intergenic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
1185342247 22:50296865-50296887 CAGTGACACCAGCAGGGGGGCGG + Intronic
1185344508 22:50305494-50305516 CAGTCTCCCCACCTGCAGGATGG + Intronic
1185357730 22:50384637-50384659 CAGTGTCCCCAGCAGCAAGAAGG - Intronic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
950427370 3:12931736-12931758 CAGTAGCTCCAGCAGGTGGATGG + Intronic
950585331 3:13888219-13888241 CAGTCTCCCCACCTGTAGGATGG - Intergenic
951180962 3:19658337-19658359 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
952413068 3:33066452-33066474 CAGAGTCCCCACCAGCAAGAAGG + Intronic
952646697 3:35668405-35668427 CAGAGACTCCAGCAGGAGCAAGG - Intronic
953878636 3:46680369-46680391 CAGTGCCCCCAGCGGGAGTGGGG + Intronic
954265760 3:49469572-49469594 CAGTGTTCCAGGCAGGGGGAGGG + Intronic
954370733 3:50168501-50168523 GGGTGTGCCAAGCAGGAGGAAGG + Intronic
954410223 3:50367358-50367380 CAGTGTGCCCAGCAGCAGGCAGG - Intronic
954436476 3:50498946-50498968 CAGTCTCCCCATCTGGAGGATGG + Intronic
954529264 3:51304236-51304258 CAGTTTCCCCAGCACCAGCAGGG + Intronic
954608146 3:51929540-51929562 CAGTGTCCCCAGAAAGAGGTGGG + Intergenic
954690540 3:52393236-52393258 CAGTCTCCCCAGCAGCCGTAGGG - Intronic
956741993 3:72282369-72282391 CAGAGTCCCCATCAGCAAGAAGG + Intergenic
956929337 3:74024953-74024975 CAAAGTCCCCACCAGGAAGAAGG + Intergenic
957997659 3:87710748-87710770 CAGAGTCCCCAGCAGCAAGTAGG + Intergenic
959321898 3:104887170-104887192 CAGAGCCCATAGCAGGAGGAGGG + Intergenic
960259352 3:115547879-115547901 CAGAGTCCCCACCATGAAGAGGG + Intergenic
961063993 3:123858509-123858531 AAGAGTCCCCACCAGCAGGAAGG - Intronic
962390504 3:134967618-134967640 CAGAGTCCCCACCAGCAAGAAGG + Intronic
962644262 3:137420386-137420408 CAGTGTGTCCAGGAGGAGAAGGG - Intergenic
966043280 3:175518586-175518608 GAGAGTCCCCATCAGCAGGAAGG - Intronic
966214597 3:177489619-177489641 CAGAGTCCCCATCAGCAAGAAGG - Intergenic
966757582 3:183385902-183385924 CAGTGTCCAAAGCAGGAAGAAGG - Intronic
967144286 3:186593067-186593089 CAGTGTCCTCACCAACAGGAAGG + Intronic
967214029 3:187194921-187194943 CAGCATCCCCAGCAGTAGCAGGG + Intergenic
967955053 3:194871687-194871709 CAGTGTCCTCAGCAGGAGCCCGG - Intergenic
968656500 4:1780545-1780567 AAGAGTCCCGAGCAGGTGGAAGG + Intergenic
969046787 4:4342161-4342183 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
969214418 4:5710925-5710947 CAGCGTCTTCATCAGGAGGATGG + Intergenic
969229307 4:5818710-5818732 CAGAGTCCCCACCAGCAAGAAGG + Intronic
969322930 4:6424027-6424049 CAGGGTCCCCGGCTGGAGGAAGG + Intronic
969499972 4:7546662-7546684 CAGCGTCCCCATGAGGAGGCAGG - Intronic
969705800 4:8790520-8790542 CCTGGTCCCCAGCAGAAGGAAGG - Intergenic
969927056 4:10594653-10594675 AAGTTTCCCCACCATGAGGAAGG - Intronic
970427986 4:15963094-15963116 CAAGGTCACCAGCAGGAGGCAGG + Exonic
971158656 4:24110000-24110022 CAGAGACCCCTGCTGGAGGATGG - Intergenic
972628453 4:40822952-40822974 CAGTGTGGCCAGCTGGAGGCAGG + Intronic
972642581 4:40939065-40939087 GAGAGTCCCCACCAGGAAGAAGG + Intronic
972876331 4:43365588-43365610 CACTGTCCCCAAGAGGAAGAAGG - Intergenic
975715655 4:77203402-77203424 CTGTGTCCCTAGCAGCAGCAGGG + Intronic
977354108 4:95924089-95924111 TAGTGACTCTAGCAGGAGGAAGG + Intergenic
977868165 4:102056162-102056184 CAGTCTCACCAGTAGGATGAGGG - Intronic
979601728 4:122592800-122592822 GAGAGTCCCCACCAGGAAGAAGG + Intergenic
981361019 4:143845727-143845749 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
981371757 4:143966729-143966751 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
981797092 4:148607854-148607876 TAGTGTTCCCAACAGGAGGAAGG - Intergenic
981849344 4:149210390-149210412 CAGAGTCCCCATCAGCAAGAAGG - Intergenic
982429841 4:155310196-155310218 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
983238558 4:165207102-165207124 CAGTGTCCCAGGCAGGAAGCAGG - Intronic
984147370 4:176079785-176079807 CAGAGTCCCAACCAGCAGGAAGG - Intronic
984435895 4:179709778-179709800 GAGAGTCCCCACCAGCAGGAAGG - Intergenic
984558609 4:181241969-181241991 CTGTGTGCCCAGAAGGAGAAAGG + Intergenic
984755386 4:183321786-183321808 CAGTGTCCCTACCTGGAAGATGG - Exonic
984758060 4:183342499-183342521 CCCTGCTCCCAGCAGGAGGAAGG - Intergenic
984973489 4:185210134-185210156 CAGGATCCCCAGCAGGAAGGCGG - Intronic
985468445 5:20564-20586 GAGTGTCTCCAGCATGAGAAGGG + Intergenic
985556536 5:561377-561399 CAGTTTCCCCATCAGCAAGATGG + Intergenic
985615282 5:916394-916416 CACTGTCCCCAGCAGCCGGTTGG + Intronic
986796926 5:11221831-11221853 AAGTGTCACCAGGAGGAGAAAGG + Intronic
986855939 5:11868813-11868835 CAGAGTCTCCAGCAGCAAGAAGG + Intronic
987051319 5:14148876-14148898 CTGGGTCCCCAGCTGGAGCAAGG + Intronic
987322486 5:16783636-16783658 CAATGTGGCCAGCAGGAGAAAGG - Intronic
987504055 5:18747189-18747211 CAGTGTCCCCAGCATCATCAGGG - Intergenic
988215591 5:28268163-28268185 GCGTGGCCCAAGCAGGAGGAAGG - Intergenic
988483094 5:31645930-31645952 CAGTGTACTCAGTAGGGGGAAGG + Intronic
989367822 5:40676254-40676276 GAGTCTCCCCTACAGGAGGAAGG - Intergenic
990339966 5:54812796-54812818 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
990969053 5:61483146-61483168 CAGAGTCCCCACCAGCAAGAAGG - Intronic
991332824 5:65510940-65510962 CAGAGTCACCAGCAGCAAGAGGG + Intergenic
992325266 5:75654199-75654221 GAGTGTCACCAGCAGATGGAGGG - Intronic
992443974 5:76818624-76818646 CGGTGGACCCTGCAGGAGGAGGG - Intergenic
992697365 5:79303349-79303371 CACTGTGCCCAGCCTGAGGAGGG + Intronic
994379353 5:99053009-99053031 GAGAGTCCCCATCAGCAGGAAGG + Intergenic
995264169 5:110138905-110138927 CAGTCTCCCCAGCACCAGCAGGG + Intergenic
995530846 5:113090640-113090662 CAGTCTACCCAGAAGGACGATGG + Intronic
995571994 5:113490349-113490371 CAGAGTCCCCACCAGCAGGGTGG + Intergenic
996482237 5:123988436-123988458 CAGTGTCCCCAGCACTGGCAGGG + Intergenic
996490278 5:124086602-124086624 CAGTTTCCCAAGAAGGAGGAAGG - Intergenic
998063397 5:139136929-139136951 CAGTCACTCCAGCAGAAGGAGGG + Intronic
998225521 5:140323427-140323449 CAGTGGCCCCAGCAGCCGGGTGG - Intergenic
998335048 5:141364377-141364399 CAGCGTCCCCAGGAGCATGAAGG - Exonic
999711775 5:154324228-154324250 CAGTGTCCCCAGCTGCTGGCAGG + Intronic
1001301391 5:170536345-170536367 CAGTTTTCCCAGCAGTAGAATGG + Intronic
1001435072 5:171693738-171693760 CAGGTCCCCCAGCAGGAGGCTGG - Intergenic
1001482762 5:172099943-172099965 CAGCGTCCTTAGGAGGAGGAAGG + Intronic
1002086798 5:176780978-176781000 CAGTGTCTCCATGAGCAGGAAGG + Intergenic
1002449508 5:179310821-179310843 CACTGTCCCCAGGAGGACTAAGG - Intronic
1002591699 5:180295152-180295174 CAGAGTCCCCAGCAGCAAGAAGG + Intergenic
1002598294 5:180338556-180338578 CAGAGTCCCCCGGACGAGGAAGG - Exonic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1002755512 6:156063-156085 GAGTGTCTCCAGCAGGAGAGGGG + Intergenic
1002889977 6:1324012-1324034 CTCTGTGCCCAGCTGGAGGATGG + Intergenic
1002933049 6:1647417-1647439 GAGTGTCCCCAGCAGGCTGAAGG + Intronic
1003117984 6:3295907-3295929 CAGAGTCCCAGGCAGGAGGCTGG - Intronic
1003513258 6:6799167-6799189 CAGTGTCCCTACCAGCAGGAAGG - Intergenic
1004191098 6:13464283-13464305 CAGTGCCCCCAGCACAAGTAAGG + Intronic
1004824660 6:19405899-19405921 CAGTGTCCCCAGCTTCAGCAGGG + Intergenic
1005452974 6:25992050-25992072 CGGTGTCCCCAGCTGGAGCAGGG + Intergenic
1005825860 6:29631655-29631677 CAGGCTCCCCAGTGGGAGGAAGG + Intronic
1005963834 6:30712456-30712478 CACTGTCCCCAAAAGGAGGTTGG + Exonic
1006241138 6:32679937-32679959 CAGTCTCCCCAGCAGTGGGACGG + Intergenic
1006778932 6:36618683-36618705 CAGTCTCCCCAGCTGGAAGTAGG + Intergenic
1006818351 6:36869370-36869392 CAGAGTCCCCACCAGCAAGAAGG - Intronic
1007377854 6:41468691-41468713 CAGAGTCCCCAGGAAGTGGAGGG - Intergenic
1011696297 6:89916549-89916571 CAATGTCCCCAGAAGGTGAAGGG - Intergenic
1013292136 6:108728824-108728846 CAGTGGCCCCTGCACTAGGAAGG + Intergenic
1014151184 6:118057401-118057423 GATGGTCCCAAGCAGGAGGAGGG + Intronic
1015935055 6:138400798-138400820 GAGAGTCCCCACCAGCAGGAAGG - Intergenic
1016458013 6:144251295-144251317 CAGTGTCCTCAGAGGGAGCATGG - Intergenic
1016762871 6:147758802-147758824 GAGTACCCCCAACAGGAGGAGGG - Intergenic
1017086504 6:150717624-150717646 CAGTGTCCCCACCTGGAGTGGGG - Intronic
1017118605 6:151002817-151002839 CAGTGGCTCACGCAGGAGGAAGG - Intronic
1017232524 6:152088679-152088701 CAGAGTCCCCAGCAGAAAGAAGG + Intronic
1017484224 6:154888328-154888350 CAGAGTCCCCATCAGCAAGAAGG - Intronic
1017512980 6:155130453-155130475 CAGTTTCCCCACCTGGAGAAGGG + Intronic
1017767672 6:157620206-157620228 CAGTGTCCCCATCAGCAAGAAGG - Intronic
1018310942 6:162507925-162507947 CAGAGTCCCAGGCAGGATGAAGG + Intronic
1018411162 6:163550194-163550216 CAGAGTCCCCACCAGCAAGAAGG - Intronic
1018446872 6:163866371-163866393 CGCTCTCCCCAGCAGGAGGCAGG - Intergenic
1018458123 6:163971240-163971262 CAGTGTCCCCACCAGCTGGGTGG - Intergenic
1018923007 6:168188786-168188808 CAGTGTCCTCAGTGGGAGGATGG + Intergenic
1019166754 6:170102299-170102321 GGGTGACCGCAGCAGGAGGAGGG + Intergenic
1019220372 6:170468402-170468424 CATTCTCCCCAGAAGAAGGAGGG - Intergenic
1019416898 7:932005-932027 CAGAGTCCCCAGCAAGAAGCCGG + Intronic
1019483431 7:1276646-1276668 CTGTGCCCCCAGCAGGGTGATGG + Intergenic
1019552282 7:1608999-1609021 CACTGTCCCCAGCAGCAAGGAGG - Intergenic
1019623246 7:2002788-2002810 CACTGTCCCCAGCAGGGAGCTGG - Intronic
1021110981 7:16694375-16694397 CAGAGTCCCCACCAGCAAGAAGG - Intronic
1022203221 7:28137914-28137936 CAGTCTCCCCATCAGGAAAATGG - Intronic
1022789742 7:33675013-33675035 CAGCGTCACCAGCAGAGGGAAGG + Intergenic
1023662226 7:42481536-42481558 GTGTGTGCACAGCAGGAGGAGGG + Intergenic
1023729416 7:43176506-43176528 CAGAGTCCCCACCAGTAAGAAGG - Intronic
1024064166 7:45718879-45718901 CAGTGGGCTCAGCAGAAGGAAGG + Exonic
1024302522 7:47898053-47898075 GAGTGTCCACAGCAGCAGGGAGG + Exonic
1024467319 7:49725321-49725343 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1024589958 7:50872653-50872675 CAGTCTCCCCAGAAGAAGCAGGG - Intergenic
1024673350 7:51616531-51616553 CAGAGTCCCCACTAGCAGGAAGG - Intergenic
1024921657 7:54563509-54563531 CAGTGTCCCCAGCAGGAGGAAGG + Intronic
1024955067 7:54910131-54910153 CAGTGTCCTCAGCAAGATGTTGG + Intergenic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1028534096 7:91872044-91872066 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1028871410 7:95774370-95774392 CACAGTCCCCTGGAGGAGGAGGG + Intronic
1029414628 7:100435378-100435400 CAGTGTCCGGTGCATGAGGAAGG + Exonic
1029458877 7:100684359-100684381 CAGTGCCCCCAGCAGGGAGGAGG + Intronic
1030028923 7:105351242-105351264 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1030860653 7:114621772-114621794 CAGTGTACCCAGCGGCAGGAGGG + Intronic
1031082975 7:117276240-117276262 CAGTTCATCCAGCAGGAGGAAGG + Intergenic
1032119630 7:129146321-129146343 CATTTTCCCCAGGAGTAGGATGG - Intronic
1033262399 7:139855121-139855143 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1034859201 7:154581708-154581730 CAGTGTCCCCTGCAGGTGCAGGG + Intronic
1035100069 7:156389244-156389266 CAGGGACACCAGCTGGAGGAAGG - Intergenic
1035106624 7:156446525-156446547 CAGAGGCCCCAGCAGGGGCAAGG - Intergenic
1035112184 7:156492341-156492363 TTGTGTCCCCAGCAGGACGCAGG + Intergenic
1035281198 7:157779530-157779552 CGTTGTCCCCAGCAGGGCGACGG + Intronic
1035457246 7:159016592-159016614 CAGGGTGCCAAGCAGGAGGGTGG - Intergenic
1035878886 8:3221969-3221991 CAGCTTCCCAAGCAGGAGGCTGG - Intronic
1037249597 8:16877139-16877161 CAGTGCCCCCAGCACCAGCAAGG + Intergenic
1037759258 8:21731008-21731030 TAGTGTCCGCAACACGAGGAAGG - Intronic
1038158827 8:25017210-25017232 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1038691864 8:29771614-29771636 CAGAGTCCCCACCAGCAGGAAGG + Intergenic
1039073845 8:33670954-33670976 GAGAGTCCCCATCAGCAGGAAGG + Intergenic
1040055758 8:43056038-43056060 TAGTGGCCCCAGCAGGGAGAGGG - Intronic
1040841804 8:51792638-51792660 CAGTCTCCCCAGCACCAGCAGGG - Intronic
1041356686 8:57007904-57007926 GAGTGTCCCCACCAGCAAGAAGG + Intergenic
1042203257 8:66302669-66302691 CACTGCACCCAGCAAGAGGATGG + Intergenic
1042867472 8:73368455-73368477 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1043257663 8:78156714-78156736 CAGTGTCCCCAGCTTCAGCAGGG - Intergenic
1044286350 8:90415369-90415391 CAGTGTCCCCAGCTGCACCAGGG + Intergenic
1044348406 8:91134061-91134083 CAGTCTCCCAAGCAGAAGGCAGG - Intronic
1044938020 8:97311820-97311842 CAGTGTCTGCAGAAGGAGAAAGG - Intergenic
1045173398 8:99695745-99695767 CAGTGTCCCCACATGAAGGAAGG + Intronic
1045348901 8:101320097-101320119 CAGAGTCCCCACCAGTAAGAAGG - Intergenic
1046611386 8:116429461-116429483 CCATGGCCACAGCAGGAGGAAGG + Intergenic
1046880597 8:119302961-119302983 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1047368722 8:124237128-124237150 GAGTGTCCTCAGCAGAAGAAGGG + Intergenic
1047624774 8:126645448-126645470 CAGTTTCTCCAGCAGGAGTGTGG + Intergenic
1048447138 8:134499885-134499907 TGGTGTCCCCAGCTGGTGGAGGG - Intronic
1048451973 8:134541408-134541430 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1048997161 8:139801225-139801247 AAGTCTCCCCAGGAAGAGGAAGG - Intronic
1049010351 8:139883240-139883262 CAGAGTCCCCAGCAGCAAGAGGG + Intronic
1049355505 8:142186344-142186366 CCATGCCCCCAGCAGGAGCATGG + Intergenic
1049409578 8:142466482-142466504 CAGTGGCCCGAGGAGGAGGGAGG + Intronic
1049695969 8:143984487-143984509 TTGAGTCCCCAGTAGGAGGAGGG + Intronic
1049807843 8:144548896-144548918 AGGTGAGCCCAGCAGGAGGAAGG + Intronic
1050088931 9:1996295-1996317 CAGTCTCCCACACAGGAGGAAGG + Intergenic
1050341602 9:4645439-4645461 CAGAGTCCCCACCAGCAAGAAGG - Intronic
1050472641 9:6008273-6008295 CCGTGTCCCCCGCAGGTAGAGGG - Intergenic
1050648939 9:7754397-7754419 CACTGTGCCCAGGAGGAAGAAGG + Intergenic
1051142185 9:13989399-13989421 AAGTGTCCTCAGCAGGAGTTTGG + Intergenic
1051154566 9:14126483-14126505 CAGTCTCCCCAGGATGAGGAAGG + Intronic
1053510969 9:38687475-38687497 CAGTGTGCAGAGCAGGAGGCGGG - Intergenic
1055802716 9:80057929-80057951 CAGTGTCCTCACTAGGAAGAAGG + Intergenic
1055828895 9:80358116-80358138 CGGGGTCCCCAGCAGGAAGCAGG - Intergenic
1056575527 9:87853443-87853465 AAGTGTCCCCAAGAGGAGCATGG + Intergenic
1056906050 9:90648756-90648778 CAGCAGCCCCAGTAGGAGGAGGG - Intergenic
1056911718 9:90707049-90707071 CAGTGTGCAGTGCAGGAGGAAGG + Intergenic
1058395404 9:104547551-104547573 CAGTGTCCCCACTAGTAAGAAGG - Intergenic
1058538497 9:105988492-105988514 CAGTGATCCCAGCATGAGGGTGG + Intergenic
1058756568 9:108088210-108088232 CTGAGTCCCCAGGAGGAGAAGGG - Intergenic
1058770451 9:108226275-108226297 AAGTGTTCCATGCAGGAGGAAGG - Intergenic
1059373330 9:113861649-113861671 CAGAGAACTCAGCAGGAGGATGG - Intergenic
1060192682 9:121603091-121603113 CAGAGGCCACAGTAGGAGGATGG - Intronic
1060201673 9:121655070-121655092 CAGTTTCCCCATCTGAAGGATGG + Intronic
1061011135 9:127955297-127955319 CAGTGCCCTCAGCAGTAGAAGGG - Intronic
1061245963 9:129401463-129401485 CAGTGACCCCAACAAAAGGAGGG + Intergenic
1061513253 9:131073449-131073471 CAGTGTCACCAGCATGGGGAGGG + Intronic
1061586795 9:131574884-131574906 CAGTTTCCCCAGCTGGAAGTGGG - Intergenic
1061589495 9:131589420-131589442 CATCTCCCCCAGCAGGAGGAAGG + Intronic
1061593736 9:131615360-131615382 CACTGCACCCAGCCGGAGGAAGG + Intronic
1061796632 9:133089211-133089233 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1061860380 9:133464875-133464897 CAGTGGCACCAGCACCAGGAAGG - Intronic
1061882419 9:133574944-133574966 CAGCGTGCCCCGCAGGAGGGGGG - Exonic
1061902481 9:133680194-133680216 CAGTGTCCCCACCTGTAGCACGG - Intronic
1061938859 9:133873441-133873463 CAGTGTCTTCAGCAGGGGCATGG - Intronic
1061950081 9:133931284-133931306 CAGAGAGCCCAGCAGCAGGAGGG + Intronic
1062050273 9:134443492-134443514 CAGCGTCGCCAGCAGGGGGCAGG - Intergenic
1062393603 9:136343676-136343698 CAGTGTCCCCATCTGGGGAACGG + Intronic
1062637533 9:137499523-137499545 CAGGGTCCCCTGCTGGTGGAGGG + Intronic
1186368177 X:8917922-8917944 GAGAGTCCCCACCAGGAAGAAGG + Intergenic
1186586111 X:10874884-10874906 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1187913455 X:24131815-24131837 GAGTTTCCACACCAGGAGGAGGG + Intergenic
1188801453 X:34536179-34536201 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1189136493 X:38555995-38556017 CAGAGTCCCCATCAGCAAGAAGG - Intronic
1189178400 X:38980835-38980857 CAGTGACACAGGCAGGAGGAGGG - Intergenic
1189470346 X:41309017-41309039 CAGTGCCCCCAGCAGGAAAGAGG - Intergenic
1189940161 X:46112976-46112998 CAGTCTCCCCAGCACCAGCAGGG + Intergenic
1190418626 X:50205548-50205570 CAGTGGCTGCGGCAGGAGGATGG + Intronic
1190583702 X:51915562-51915584 CAGTGTCCCCAGCAGCAAGAGGG + Intergenic
1191768851 X:64733162-64733184 CAGTGTCCCCAGCACCAGCAGGG + Intergenic
1194375545 X:93128331-93128353 CAGAGTCCCCACCAGCAGGGAGG + Intergenic
1194810246 X:98380257-98380279 CAGGGTGCCCAGCAGCAGGCTGG - Intergenic
1196145005 X:112306837-112306859 CAGTGGCCACAGCAGGAAGCTGG + Intergenic
1196787105 X:119430527-119430549 CAGTGTCAGCAGCAGGCTGATGG + Intronic
1199718501 X:150525042-150525064 CAGTCTGCCCATCAGGAAGAGGG + Intergenic
1199735966 X:150687014-150687036 CAGCGTTCCCACCAGGAAGAAGG - Intergenic
1200179092 X:154139590-154139612 CTGTGTCCTCATCAGGAAGATGG - Intergenic