ID: 1024927492

View in Genome Browser
Species Human (GRCh38)
Location 7:54632849-54632871
Sequence GTCAAAGTCTCCCATGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024927487_1024927492 30 Left 1024927487 7:54632796-54632818 CCTGGGGCTTAGATGCATCTTGT No data
Right 1024927492 7:54632849-54632871 GTCAAAGTCTCCCATGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024927492 Original CRISPR GTCAAAGTCTCCCATGGTGC TGG Intergenic
No off target data available for this crispr