ID: 1024929242

View in Genome Browser
Species Human (GRCh38)
Location 7:54652623-54652645
Sequence CAGGACTGGCTTTCCTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024929242_1024929252 27 Left 1024929242 7:54652623-54652645 CCAACAAAGGAAAGCCAGTCCTG No data
Right 1024929252 7:54652673-54652695 GGTCAGAGAAGCCTCCTCAAGGG No data
1024929242_1024929249 6 Left 1024929242 7:54652623-54652645 CCAACAAAGGAAAGCCAGTCCTG No data
Right 1024929249 7:54652652-54652674 GGGGAGCACCTGAGCGCTGCTGG No data
1024929242_1024929251 26 Left 1024929242 7:54652623-54652645 CCAACAAAGGAAAGCCAGTCCTG No data
Right 1024929251 7:54652672-54652694 TGGTCAGAGAAGCCTCCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024929242 Original CRISPR CAGGACTGGCTTTCCTTTGT TGG (reversed) Intergenic
No off target data available for this crispr