ID: 1024934501

View in Genome Browser
Species Human (GRCh38)
Location 7:54698824-54698846
Sequence CTCTATCAGCAGAGGCTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024934498_1024934501 -1 Left 1024934498 7:54698802-54698824 CCTATGGGCTCTGATGACCAAAC No data
Right 1024934501 7:54698824-54698846 CTCTATCAGCAGAGGCTCTCAGG No data
1024934496_1024934501 1 Left 1024934496 7:54698800-54698822 CCCCTATGGGCTCTGATGACCAA No data
Right 1024934501 7:54698824-54698846 CTCTATCAGCAGAGGCTCTCAGG No data
1024934497_1024934501 0 Left 1024934497 7:54698801-54698823 CCCTATGGGCTCTGATGACCAAA No data
Right 1024934501 7:54698824-54698846 CTCTATCAGCAGAGGCTCTCAGG No data
1024934494_1024934501 11 Left 1024934494 7:54698790-54698812 CCCATTTATTCCCCTATGGGCTC No data
Right 1024934501 7:54698824-54698846 CTCTATCAGCAGAGGCTCTCAGG No data
1024934495_1024934501 10 Left 1024934495 7:54698791-54698813 CCATTTATTCCCCTATGGGCTCT No data
Right 1024934501 7:54698824-54698846 CTCTATCAGCAGAGGCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024934501 Original CRISPR CTCTATCAGCAGAGGCTCTC AGG Intergenic
No off target data available for this crispr