ID: 1024934929

View in Genome Browser
Species Human (GRCh38)
Location 7:54702266-54702288
Sequence CTTTATTCGTAGAGGCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024934920_1024934929 24 Left 1024934920 7:54702219-54702241 CCCCTGATGGGCAGTGGGGTCTC No data
Right 1024934929 7:54702266-54702288 CTTTATTCGTAGAGGCCAGATGG No data
1024934922_1024934929 22 Left 1024934922 7:54702221-54702243 CCTGATGGGCAGTGGGGTCTCAG No data
Right 1024934929 7:54702266-54702288 CTTTATTCGTAGAGGCCAGATGG No data
1024934919_1024934929 25 Left 1024934919 7:54702218-54702240 CCCCCTGATGGGCAGTGGGGTCT No data
Right 1024934929 7:54702266-54702288 CTTTATTCGTAGAGGCCAGATGG No data
1024934921_1024934929 23 Left 1024934921 7:54702220-54702242 CCCTGATGGGCAGTGGGGTCTCA No data
Right 1024934929 7:54702266-54702288 CTTTATTCGTAGAGGCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024934929 Original CRISPR CTTTATTCGTAGAGGCCAGA TGG Intergenic
No off target data available for this crispr