ID: 1024935074

View in Genome Browser
Species Human (GRCh38)
Location 7:54703369-54703391
Sequence TATGCTGGACAACCCAACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024935074_1024935081 30 Left 1024935074 7:54703369-54703391 CCCCTGTTGGGTTGTCCAGCATA No data
Right 1024935081 7:54703422-54703444 AGATATTATCCCTACTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024935074 Original CRISPR TATGCTGGACAACCCAACAG GGG (reversed) Intergenic
No off target data available for this crispr