ID: 1024936835

View in Genome Browser
Species Human (GRCh38)
Location 7:54719490-54719512
Sequence GTGGCCAGGAGGAAATCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024936835_1024936839 -2 Left 1024936835 7:54719490-54719512 CCAACTGATTTCCTCCTGGCCAC No data
Right 1024936839 7:54719511-54719533 ACAGCAACTCACTATGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024936835 Original CRISPR GTGGCCAGGAGGAAATCAGT TGG (reversed) Intergenic
No off target data available for this crispr