ID: 1024940542

View in Genome Browser
Species Human (GRCh38)
Location 7:54759058-54759080
Sequence GCGAGCCGGCGTGTCTCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024940542_1024940549 8 Left 1024940542 7:54759058-54759080 CCCGGGGAGACACGCCGGCTCGC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1024940549 7:54759089-54759111 GCTGCCCCCAAGAGTCGCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 65
1024940542_1024940552 13 Left 1024940542 7:54759058-54759080 CCCGGGGAGACACGCCGGCTCGC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1024940552 7:54759094-54759116 CCCCAAGAGTCGCAAAGGTGTGG 0: 1
1: 0
2: 1
3: 9
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024940542 Original CRISPR GCGAGCCGGCGTGTCTCCCC GGG (reversed) Intronic
900205175 1:1428318-1428340 CCGAGCGTGGGTGTCTCCCCTGG - Intergenic
902191520 1:14766449-14766471 GCCAGCCGGCATCTCTTCCCTGG - Intronic
922440507 1:225652575-225652597 CCGGCCCGGCGCGTCTCCCCTGG - Intronic
922672225 1:227519259-227519281 GAGAGCCTGAGAGTCTCCCCTGG + Intergenic
924822182 1:247503884-247503906 GAGAGCCTGAGTGTCTCCCGGGG + Intergenic
1072283715 10:93893850-93893872 GGGAGGCAGCGGGTCTCCCCAGG + Intergenic
1072706910 10:97687400-97687422 GTGAGGGGGCGTGTCTGCCCGGG + Intergenic
1076354538 10:129842311-129842333 GGGAGCCGGCCTGTCACCCCAGG + Intronic
1089209656 11:116791573-116791595 GCGAGCCCGCGTGAGTGCCCAGG - Exonic
1090838538 11:130471017-130471039 GTACTCCGGCGTGTCTCCCCGGG + Exonic
1092123851 12:6062622-6062644 GGGAGCAGGGGTGTCTCCCTGGG - Intronic
1093859970 12:24153263-24153285 GCCAGCCTGCGTGTGTCCTCTGG + Intergenic
1104223771 12:126811552-126811574 GCCAGCTGGTGTCTCTCCCCAGG + Intergenic
1105013680 12:132773164-132773186 GTGGGCCGGCGTGACCCCCCGGG + Exonic
1105899055 13:24741157-24741179 GCTCGCCAGGGTGTCTCCCCAGG - Intergenic
1132571959 16:648057-648079 GCCAGCCGGCAAGTCTCCCCTGG - Intronic
1146008340 17:29176541-29176563 GAGAGCCGGCCTCTCTCCCTTGG + Intronic
1152244669 17:79179013-79179035 GCGAGCCAGCGTGTCTCAGACGG + Intronic
1160768865 19:821631-821653 GCCGGCCACCGTGTCTCCCCCGG - Intronic
1160791778 19:926653-926675 GGGGGCCGCGGTGTCTCCCCCGG - Intronic
1161286069 19:3468927-3468949 GAGAGCCGGCGGGTCTGCCCAGG - Intronic
1161560175 19:4968881-4968903 GGGCGCCGGCGTGTCCCCGCCGG + Intergenic
1162795031 19:13082567-13082589 GGGAGCCAGTGTGTCTCCCAGGG - Intronic
1168275384 19:55275053-55275075 GGGAGCCGGCCTGGCTCTCCCGG - Intronic
935666800 2:105519138-105519160 GGGAGCAAGTGTGTCTCCCCAGG - Intergenic
1176100949 20:63364306-63364328 GCCAGCAGGCCTGTCTCTCCCGG + Intronic
1176307414 21:5131091-5131113 GCGAGCCGACGGGTCACGCCAGG - Exonic
1179849646 21:44130939-44130961 GCGAGCCGACGGGTCACGCCAGG + Exonic
1180197625 21:46207160-46207182 GGGAGCCGGCGTGGCCCCCAAGG - Intronic
1180846372 22:18984666-18984688 GTGAGCCACCGTGTCTGCCCTGG + Intergenic
1183291108 22:37002523-37002545 GCCAGCCTGCGTGCCTCCCACGG + Intronic
949480988 3:4493576-4493598 CCAAACCGGCGTGGCTCCCCGGG + Exonic
961260098 3:125595344-125595366 GGGAGCCGGCGTCCCGCCCCCGG - Intergenic
969716735 4:8871570-8871592 GCGGGCCGGCGTGGCGCGCCCGG + Exonic
981028770 4:140102729-140102751 GGGAGCCAGGGTGTCTACCCTGG - Intronic
1002185936 5:177454842-177454864 GCGCGCGGGCGTGCCTCACCCGG - Exonic
1002394220 5:178940842-178940864 GCGATCGGGCGTCGCTCCCCTGG + Intergenic
1003133748 6:3417227-3417249 GCGAGCCAGTGTGTGTCCCAAGG - Intronic
1006665290 6:35688926-35688948 GCGAGCCGGCCCGAATCCCCGGG + Intronic
1011077774 6:83455622-83455644 GCGAGCCACCGTGTCTGGCCTGG + Intergenic
1019592861 7:1844398-1844420 CCCAACCGGCGTCTCTCCCCAGG - Intronic
1024785369 7:52901441-52901463 TGGAGCCAGCATGTCTCCCCAGG + Intergenic
1024940542 7:54759058-54759080 GCGAGCCGGCGTGTCTCCCCGGG - Intronic
1034426562 7:151017081-151017103 GCGAGCCGAGGTGGCACCCCAGG + Exonic
1039064921 8:33599527-33599549 GCGAGCCAGCCTCTCTCTCCCGG - Intronic
1049693344 8:143972305-143972327 GGGTGCAGGAGTGTCTCCCCTGG + Intronic
1049773551 8:144394611-144394633 CCCACCCGGCGTGTGTCCCCCGG - Intronic
1052049778 9:23831500-23831522 TCTAGCCGCTGTGTCTCCCCGGG - Intergenic
1052192736 9:25677924-25677946 GGGACCCGGCGTGCCTCCGCGGG + Exonic
1057800930 9:98191355-98191377 GGGAGCCGAGGTGTCTGCCCTGG - Intronic
1062668400 9:137691860-137691882 GCGAAGCGCCCTGTCTCCCCTGG + Intronic
1198105162 X:133455035-133455057 GTGAGCCCGGGTGTCTTCCCTGG - Intergenic