ID: 1024943551

View in Genome Browser
Species Human (GRCh38)
Location 7:54786080-54786102
Sequence ATGGCTAAGGGCAGTTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024943551_1024943558 15 Left 1024943551 7:54786080-54786102 CCAACCAAACTGCCCTTAGCCAT No data
Right 1024943558 7:54786118-54786140 TGCCTAGAAGTTCACCCTCTTGG No data
1024943551_1024943560 24 Left 1024943551 7:54786080-54786102 CCAACCAAACTGCCCTTAGCCAT No data
Right 1024943560 7:54786127-54786149 GTTCACCCTCTTGGCAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024943551 Original CRISPR ATGGCTAAGGGCAGTTTGGT TGG (reversed) Intergenic
No off target data available for this crispr