ID: 1024943558

View in Genome Browser
Species Human (GRCh38)
Location 7:54786118-54786140
Sequence TGCCTAGAAGTTCACCCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024943550_1024943558 19 Left 1024943550 7:54786076-54786098 CCTTCCAACCAAACTGCCCTTAG No data
Right 1024943558 7:54786118-54786140 TGCCTAGAAGTTCACCCTCTTGG No data
1024943552_1024943558 11 Left 1024943552 7:54786084-54786106 CCAAACTGCCCTTAGCCATTCAG No data
Right 1024943558 7:54786118-54786140 TGCCTAGAAGTTCACCCTCTTGG No data
1024943551_1024943558 15 Left 1024943551 7:54786080-54786102 CCAACCAAACTGCCCTTAGCCAT No data
Right 1024943558 7:54786118-54786140 TGCCTAGAAGTTCACCCTCTTGG No data
1024943555_1024943558 2 Left 1024943555 7:54786093-54786115 CCTTAGCCATTCAGCATGGCCTT No data
Right 1024943558 7:54786118-54786140 TGCCTAGAAGTTCACCCTCTTGG No data
1024943556_1024943558 -4 Left 1024943556 7:54786099-54786121 CCATTCAGCATGGCCTTGCTGCC No data
Right 1024943558 7:54786118-54786140 TGCCTAGAAGTTCACCCTCTTGG No data
1024943554_1024943558 3 Left 1024943554 7:54786092-54786114 CCCTTAGCCATTCAGCATGGCCT No data
Right 1024943558 7:54786118-54786140 TGCCTAGAAGTTCACCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024943558 Original CRISPR TGCCTAGAAGTTCACCCTCT TGG Intergenic
No off target data available for this crispr