ID: 1024943560

View in Genome Browser
Species Human (GRCh38)
Location 7:54786127-54786149
Sequence GTTCACCCTCTTGGCAACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024943550_1024943560 28 Left 1024943550 7:54786076-54786098 CCTTCCAACCAAACTGCCCTTAG No data
Right 1024943560 7:54786127-54786149 GTTCACCCTCTTGGCAACTGTGG No data
1024943556_1024943560 5 Left 1024943556 7:54786099-54786121 CCATTCAGCATGGCCTTGCTGCC No data
Right 1024943560 7:54786127-54786149 GTTCACCCTCTTGGCAACTGTGG No data
1024943551_1024943560 24 Left 1024943551 7:54786080-54786102 CCAACCAAACTGCCCTTAGCCAT No data
Right 1024943560 7:54786127-54786149 GTTCACCCTCTTGGCAACTGTGG No data
1024943552_1024943560 20 Left 1024943552 7:54786084-54786106 CCAAACTGCCCTTAGCCATTCAG No data
Right 1024943560 7:54786127-54786149 GTTCACCCTCTTGGCAACTGTGG No data
1024943554_1024943560 12 Left 1024943554 7:54786092-54786114 CCCTTAGCCATTCAGCATGGCCT No data
Right 1024943560 7:54786127-54786149 GTTCACCCTCTTGGCAACTGTGG No data
1024943557_1024943560 -8 Left 1024943557 7:54786112-54786134 CCTTGCTGCCTAGAAGTTCACCC No data
Right 1024943560 7:54786127-54786149 GTTCACCCTCTTGGCAACTGTGG No data
1024943555_1024943560 11 Left 1024943555 7:54786093-54786115 CCTTAGCCATTCAGCATGGCCTT No data
Right 1024943560 7:54786127-54786149 GTTCACCCTCTTGGCAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024943560 Original CRISPR GTTCACCCTCTTGGCAACTG TGG Intergenic
No off target data available for this crispr