ID: 1024945288

View in Genome Browser
Species Human (GRCh38)
Location 7:54801895-54801917
Sequence ATTTATATACAGGAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024945288_1024945292 -2 Left 1024945288 7:54801895-54801917 CCATCCACCTCCTGTATATAAAT No data
Right 1024945292 7:54801916-54801938 ATAAACCTAAGATCATTAAAAGG No data
1024945288_1024945293 -1 Left 1024945288 7:54801895-54801917 CCATCCACCTCCTGTATATAAAT No data
Right 1024945293 7:54801917-54801939 TAAACCTAAGATCATTAAAAGGG No data
1024945288_1024945295 17 Left 1024945288 7:54801895-54801917 CCATCCACCTCCTGTATATAAAT No data
Right 1024945295 7:54801935-54801957 AAGGGATGTCATGACTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024945288 Original CRISPR ATTTATATACAGGAGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr