ID: 1024945292

View in Genome Browser
Species Human (GRCh38)
Location 7:54801916-54801938
Sequence ATAAACCTAAGATCATTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024945284_1024945292 16 Left 1024945284 7:54801877-54801899 CCACAAAACCCCATTTTTCCATC No data
Right 1024945292 7:54801916-54801938 ATAAACCTAAGATCATTAAAAGG No data
1024945287_1024945292 6 Left 1024945287 7:54801887-54801909 CCATTTTTCCATCCACCTCCTGT No data
Right 1024945292 7:54801916-54801938 ATAAACCTAAGATCATTAAAAGG No data
1024945290_1024945292 -9 Left 1024945290 7:54801902-54801924 CCTCCTGTATATAAATAAACCTA No data
Right 1024945292 7:54801916-54801938 ATAAACCTAAGATCATTAAAAGG No data
1024945289_1024945292 -6 Left 1024945289 7:54801899-54801921 CCACCTCCTGTATATAAATAAAC No data
Right 1024945292 7:54801916-54801938 ATAAACCTAAGATCATTAAAAGG No data
1024945286_1024945292 7 Left 1024945286 7:54801886-54801908 CCCATTTTTCCATCCACCTCCTG No data
Right 1024945292 7:54801916-54801938 ATAAACCTAAGATCATTAAAAGG No data
1024945288_1024945292 -2 Left 1024945288 7:54801895-54801917 CCATCCACCTCCTGTATATAAAT No data
Right 1024945292 7:54801916-54801938 ATAAACCTAAGATCATTAAAAGG No data
1024945285_1024945292 8 Left 1024945285 7:54801885-54801907 CCCCATTTTTCCATCCACCTCCT No data
Right 1024945292 7:54801916-54801938 ATAAACCTAAGATCATTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024945292 Original CRISPR ATAAACCTAAGATCATTAAA AGG Intergenic
No off target data available for this crispr