ID: 1024945295

View in Genome Browser
Species Human (GRCh38)
Location 7:54801935-54801957
Sequence AAGGGATGTCATGACTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024945291_1024945295 7 Left 1024945291 7:54801905-54801927 CCTGTATATAAATAAACCTAAGA No data
Right 1024945295 7:54801935-54801957 AAGGGATGTCATGACTTGAGAGG No data
1024945288_1024945295 17 Left 1024945288 7:54801895-54801917 CCATCCACCTCCTGTATATAAAT No data
Right 1024945295 7:54801935-54801957 AAGGGATGTCATGACTTGAGAGG No data
1024945286_1024945295 26 Left 1024945286 7:54801886-54801908 CCCATTTTTCCATCCACCTCCTG No data
Right 1024945295 7:54801935-54801957 AAGGGATGTCATGACTTGAGAGG No data
1024945294_1024945295 -9 Left 1024945294 7:54801921-54801943 CCTAAGATCATTAAAAGGGATGT No data
Right 1024945295 7:54801935-54801957 AAGGGATGTCATGACTTGAGAGG No data
1024945285_1024945295 27 Left 1024945285 7:54801885-54801907 CCCCATTTTTCCATCCACCTCCT No data
Right 1024945295 7:54801935-54801957 AAGGGATGTCATGACTTGAGAGG No data
1024945289_1024945295 13 Left 1024945289 7:54801899-54801921 CCACCTCCTGTATATAAATAAAC No data
Right 1024945295 7:54801935-54801957 AAGGGATGTCATGACTTGAGAGG No data
1024945290_1024945295 10 Left 1024945290 7:54801902-54801924 CCTCCTGTATATAAATAAACCTA No data
Right 1024945295 7:54801935-54801957 AAGGGATGTCATGACTTGAGAGG No data
1024945287_1024945295 25 Left 1024945287 7:54801887-54801909 CCATTTTTCCATCCACCTCCTGT No data
Right 1024945295 7:54801935-54801957 AAGGGATGTCATGACTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024945295 Original CRISPR AAGGGATGTCATGACTTGAG AGG Intergenic
No off target data available for this crispr