ID: 1024945612

View in Genome Browser
Species Human (GRCh38)
Location 7:54804877-54804899
Sequence CACTGATGGTGTGAGTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024945607_1024945612 -5 Left 1024945607 7:54804859-54804881 CCTGGGCCTTCCCTGTCACACTG No data
Right 1024945612 7:54804877-54804899 CACTGATGGTGTGAGTATGTAGG No data
1024945606_1024945612 -4 Left 1024945606 7:54804858-54804880 CCCTGGGCCTTCCCTGTCACACT No data
Right 1024945612 7:54804877-54804899 CACTGATGGTGTGAGTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024945612 Original CRISPR CACTGATGGTGTGAGTATGT AGG Intergenic
No off target data available for this crispr