ID: 1024949083

View in Genome Browser
Species Human (GRCh38)
Location 7:54839694-54839716
Sequence AGATGCAGCCTGCAGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024949083_1024949091 7 Left 1024949083 7:54839694-54839716 CCTCCCATCTGCAGGCTGCATCT No data
Right 1024949091 7:54839724-54839746 GCTTGGGACAGCCTTGGCCAGGG No data
1024949083_1024949093 15 Left 1024949083 7:54839694-54839716 CCTCCCATCTGCAGGCTGCATCT No data
Right 1024949093 7:54839732-54839754 CAGCCTTGGCCAGGGCTGCAGGG No data
1024949083_1024949088 -9 Left 1024949083 7:54839694-54839716 CCTCCCATCTGCAGGCTGCATCT No data
Right 1024949088 7:54839708-54839730 GCTGCATCTGCACTTGGCTTGGG No data
1024949083_1024949087 -10 Left 1024949083 7:54839694-54839716 CCTCCCATCTGCAGGCTGCATCT No data
Right 1024949087 7:54839707-54839729 GGCTGCATCTGCACTTGGCTTGG No data
1024949083_1024949089 1 Left 1024949083 7:54839694-54839716 CCTCCCATCTGCAGGCTGCATCT No data
Right 1024949089 7:54839718-54839740 CACTTGGCTTGGGACAGCCTTGG No data
1024949083_1024949092 14 Left 1024949083 7:54839694-54839716 CCTCCCATCTGCAGGCTGCATCT No data
Right 1024949092 7:54839731-54839753 ACAGCCTTGGCCAGGGCTGCAGG No data
1024949083_1024949090 6 Left 1024949083 7:54839694-54839716 CCTCCCATCTGCAGGCTGCATCT No data
Right 1024949090 7:54839723-54839745 GGCTTGGGACAGCCTTGGCCAGG No data
1024949083_1024949096 28 Left 1024949083 7:54839694-54839716 CCTCCCATCTGCAGGCTGCATCT No data
Right 1024949096 7:54839745-54839767 GGCTGCAGGGTGTTCCCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024949083 Original CRISPR AGATGCAGCCTGCAGATGGG AGG (reversed) Intergenic
No off target data available for this crispr