ID: 1024955093

View in Genome Browser
Species Human (GRCh38)
Location 7:54910281-54910303
Sequence AAGAGTAAACACATTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024955091_1024955093 -3 Left 1024955091 7:54910261-54910283 CCTACTGGAGGAAAAGGTTCAAG No data
Right 1024955093 7:54910281-54910303 AAGAGTAAACACATTGAGGAAGG No data
1024955087_1024955093 5 Left 1024955087 7:54910253-54910275 CCCAATACCCTACTGGAGGAAAA No data
Right 1024955093 7:54910281-54910303 AAGAGTAAACACATTGAGGAAGG No data
1024955090_1024955093 -2 Left 1024955090 7:54910260-54910282 CCCTACTGGAGGAAAAGGTTCAA No data
Right 1024955093 7:54910281-54910303 AAGAGTAAACACATTGAGGAAGG No data
1024955088_1024955093 4 Left 1024955088 7:54910254-54910276 CCAATACCCTACTGGAGGAAAAG No data
Right 1024955093 7:54910281-54910303 AAGAGTAAACACATTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024955093 Original CRISPR AAGAGTAAACACATTGAGGA AGG Intergenic
No off target data available for this crispr