ID: 1024959330

View in Genome Browser
Species Human (GRCh38)
Location 7:54958174-54958196
Sequence TAGGAGAGGTATTAAGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024959324_1024959330 3 Left 1024959324 7:54958148-54958170 CCATGGAGTGAGGAGGACAAGGT No data
Right 1024959330 7:54958174-54958196 TAGGAGAGGTATTAAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024959330 Original CRISPR TAGGAGAGGTATTAAGGGGA TGG Intergenic
No off target data available for this crispr