ID: 1024961484

View in Genome Browser
Species Human (GRCh38)
Location 7:54981381-54981403
Sequence CTGAGTACACAAATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024961479_1024961484 16 Left 1024961479 7:54981342-54981364 CCAGGCCTTGGGTCCTTGCTGGC No data
Right 1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG No data
1024961482_1024961484 3 Left 1024961482 7:54981355-54981377 CCTTGCTGGCTCTCAGTGGTGAG No data
Right 1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG No data
1024961476_1024961484 27 Left 1024961476 7:54981331-54981353 CCAGGTTGTTTCCAGGCCTTGGG No data
Right 1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG No data
1024961480_1024961484 11 Left 1024961480 7:54981347-54981369 CCTTGGGTCCTTGCTGGCTCTCA No data
Right 1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024961484 Original CRISPR CTGAGTACACAAATGGACAA TGG Intergenic
No off target data available for this crispr