ID: 1024966197

View in Genome Browser
Species Human (GRCh38)
Location 7:55023976-55023998
Sequence CAAGCTGGCCAGTTTGAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024966193_1024966197 -5 Left 1024966193 7:55023958-55023980 CCATTGGGCCCATAGGCACAAGC 0: 1
1: 0
2: 1
3: 7
4: 169
Right 1024966197 7:55023976-55023998 CAAGCTGGCCAGTTTGAATTTGG 0: 1
1: 0
2: 2
3: 8
4: 124
1024966192_1024966197 -2 Left 1024966192 7:55023955-55023977 CCTCCATTGGGCCCATAGGCACA 0: 1
1: 0
2: 1
3: 8
4: 101
Right 1024966197 7:55023976-55023998 CAAGCTGGCCAGTTTGAATTTGG 0: 1
1: 0
2: 2
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024966197 Original CRISPR CAAGCTGGCCAGTTTGAATT TGG Intronic
901462670 1:9400901-9400923 CAAGCCGGCCGGTTCTAATTAGG + Intergenic
901546028 1:9957708-9957730 GAAGCTGGTGAGTTTGAGTTCGG + Intronic
903193214 1:21668248-21668270 GAAGCTGGCCAGGTGGAAGTAGG - Intronic
906618633 1:47254933-47254955 CAAGCTAGCCAATTTCAATTTGG + Intronic
907262015 1:53225866-53225888 CAAGCTGGCCTGTTTTTAGTAGG + Intergenic
911960597 1:104297535-104297557 CATGTTGGCCAGGATGAATTGGG - Intergenic
912342810 1:108934359-108934381 TAAGGAGGCCAGTTTGAATTGGG - Exonic
921148106 1:212378341-212378363 CAAGATGGCCAGCTTGAAGCAGG + Intronic
1063170268 10:3503519-3503541 CAAGCTGCCCACTTTGAAAATGG + Intergenic
1064447867 10:15412509-15412531 CAAGGTGGCCTGGTTTAATTAGG + Intergenic
1065883358 10:30057254-30057276 CAAACTGGCCAGTGAGAACTTGG + Intronic
1065902706 10:30222974-30222996 ACAGCTGCCCAGTTTGACTTTGG + Intergenic
1067372652 10:45699631-45699653 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1067387126 10:45826493-45826515 TAAGTGGGCCAGTTTGAACTTGG - Exonic
1067419001 10:46130758-46130780 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1067447147 10:46358114-46358136 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1067504354 10:46837347-46837369 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1067590232 10:47502646-47502668 TAAGTGGGCCAGTTTGAACTTGG - Exonic
1067637352 10:48010748-48010770 TAAGTGGGCCAGTTTGAACTTGG - Intergenic
1067876135 10:50009586-50009608 TAAGTGGGCCAGTTTGAACTTGG + Exonic
1068850880 10:61738907-61738929 TAAGCAGAACAGTTTGAATTTGG + Intronic
1070133950 10:73675177-73675199 TAAGTGGGCCAGTTTGAACTTGG - Exonic
1071607765 10:87009305-87009327 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1073675427 10:105641890-105641912 CATTCTGGCCAGATTCAATTTGG + Intergenic
1082031521 11:47607827-47607849 CAATGTAGCCAGTTTGAGTTGGG + Intergenic
1083395302 11:62387245-62387267 GACGCTGGGCAGTTTGAGTTAGG - Intronic
1086437286 11:86794305-86794327 CATGCTGGCCACTTCAAATTTGG + Intronic
1087992436 11:104761726-104761748 CAATCCGGCAAGATTGAATTAGG + Intergenic
1088025336 11:105174025-105174047 CAAGGTTGCTAGTTTGTATTTGG - Intergenic
1088364603 11:109026554-109026576 CAACCTGGCAAGATTGAATCAGG - Intergenic
1091639383 12:2223461-2223483 TAACCTGGCCATTTTGAATAAGG + Intronic
1094150794 12:27280856-27280878 CAAGAAGGGCAGTTTGAATCAGG + Intronic
1100688970 12:97018617-97018639 CAAGCTGAGGAGATTGAATTTGG - Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1109055794 13:57546863-57546885 CACACTGGCCAGTTTGGATTTGG + Intergenic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1112057781 13:95706723-95706745 CAAGTTGGTCAGTTTCATTTGGG + Intronic
1112733389 13:102392731-102392753 CTTAGTGGCCAGTTTGAATTTGG - Intronic
1115142105 14:30183829-30183851 GAAGCTGGTCAGTTTGAAGTAGG + Intronic
1115322457 14:32098352-32098374 AAATGTGGCTAGTTTGAATTAGG + Intronic
1120614005 14:86679030-86679052 CAAACAGGCCAGTTTCAGTTGGG - Intergenic
1120712525 14:87807567-87807589 CAAGCAGGCCTGTTAGGATTGGG + Intergenic
1121880331 14:97494694-97494716 CATGCTGGTCAGTTTTCATTTGG + Intergenic
1121951446 14:98174223-98174245 CAGCCTGGCCAGGTTTAATTTGG - Intergenic
1127627574 15:60795352-60795374 CAAGCAGCCCATTTTGAGTTGGG - Intronic
1129517131 15:76163610-76163632 CCAGCTGGCCACTTGGAACTGGG + Intronic
1132231602 15:100188538-100188560 CATGCTGGTCAACTTGAATTGGG - Intronic
1132294076 15:100722349-100722371 CAAGATGGCGAGTTTGAAGCGGG - Intergenic
1135616843 16:23918118-23918140 CAAGAGGGGCAGTTTGACTTGGG + Intronic
1146515600 17:33486791-33486813 AAAGCTGGCCAGTGAGAAGTGGG - Intronic
1149181380 17:53941440-53941462 CAAGCTGGCCAGTTGGCACATGG + Intergenic
1153424241 18:4945122-4945144 CAGTCTGGCCAGTTTTACTTGGG - Intergenic
1155537470 18:26832212-26832234 CAAACTGACCAGTAAGAATTTGG - Intergenic
1162097864 19:8321557-8321579 CAAGCTGGCCAGGGTGAGGTGGG + Exonic
926712746 2:15895719-15895741 CAGGCTGGCCAGTTTGGGTTTGG - Intergenic
932131252 2:69189437-69189459 CTTACTGGCCAGTGTGAATTTGG - Intronic
937500527 2:122473627-122473649 CTAGCTGGCTGGTTTGTATTTGG + Intergenic
944597381 2:201273386-201273408 CAAGCTGGCAAGTTTGAAATAGG + Intronic
944678407 2:202053549-202053571 AAAGATGGCCAGTGTGACTTGGG - Intergenic
945491290 2:210458358-210458380 CTAGCAGGCCAGTTAGGATTTGG + Intronic
947138026 2:226994404-226994426 AAAGCTGAAGAGTTTGAATTGGG + Intronic
948189795 2:236049063-236049085 CAACTGGGCCAGTTTGAACTTGG + Exonic
1169959340 20:11141600-11141622 GATGCTGGCCATATTGAATTAGG - Intergenic
1174802836 20:53579487-53579509 AAAGCTGGCCATTCTGTATTTGG - Intronic
1177574505 21:22934130-22934152 CAACCTTGCAAGTTTGAACTTGG - Intergenic
1178815554 21:35925846-35925868 CAGGCTTGCCAGTTCGAAGTCGG - Intronic
949600238 3:5590375-5590397 AAATTTGGCCAGTGTGAATTTGG + Intergenic
952161210 3:30695251-30695273 CATGCTGGCCAGTGTTAAGTTGG + Intergenic
952289534 3:32002060-32002082 CAACCTGGGCAGTTTAAACTGGG - Intronic
957415550 3:79898363-79898385 TAATCTGGCCTGTTTGGATTGGG + Intergenic
959462439 3:106643853-106643875 CCAGCTGGCCACTCTGAATGCGG - Intergenic
959912721 3:111781969-111781991 CAACCTGCCTATTTTGAATTTGG + Intronic
960010091 3:112824401-112824423 GAAGCTGTCCAGTTGGAAGTTGG + Intronic
961250209 3:125496844-125496866 CATGGTGGTCAGTTTGAAATGGG - Intronic
964333661 3:155632045-155632067 CAAGCTGGCCAGACTGGCTTAGG - Intronic
966237306 3:177716363-177716385 CATGTTGGCCAGTTTCAATGTGG - Intergenic
966549080 3:181184046-181184068 CATGCAAGCCAGTTTGAAGTGGG + Intergenic
970211284 4:13712410-13712432 AAATGTGGCTAGTTTGAATTGGG + Intergenic
971273413 4:25172565-25172587 CAAAGTGACCACTTTGAATTTGG + Intronic
971604184 4:28636230-28636252 AAACCTGGCCAGTTTGACTCAGG + Intergenic
975489838 4:74976276-74976298 GAAGCTGGGCAGTTTGGACTGGG + Intronic
979798718 4:124878852-124878874 AAAGGAGGCTAGTTTGAATTAGG + Intergenic
980467341 4:133203047-133203069 CAAGCTGGCCATTATGTCTTGGG - Intronic
981981409 4:150796285-150796307 CAAGTTGACCTCTTTGAATTAGG + Intronic
982211463 4:153039957-153039979 GGAGTTGGCCAATTTGAATTTGG + Intergenic
982602800 4:157472876-157472898 CAATCTGACCAGTTTGACTATGG - Intergenic
983760923 4:171405486-171405508 CAGCCTGGCCAGTTAGAAGTAGG + Intergenic
983831667 4:172335658-172335680 CAAGCTCCCCAGATTGAATCAGG - Intronic
983932337 4:173466074-173466096 CAAAATGGCCAGTCTGAAGTTGG + Intergenic
984398489 4:179230268-179230290 AAAGCTGGCCAGAGAGAATTTGG + Intergenic
984771001 4:183436283-183436305 CCCGCTGGCCAGTTGCAATTCGG - Intergenic
985072940 4:186186048-186186070 GGAGCTGGCAAGTTTGAAATCGG + Intergenic
991100445 5:62786129-62786151 AAAGCTAGTCACTTTGAATTGGG + Intergenic
995302940 5:110606224-110606246 CAAGCAGGCCATGTTTAATTTGG + Exonic
996062666 5:119049283-119049305 CCAGCTGGCCATTCTTAATTGGG + Intronic
996217768 5:120890177-120890199 CAAGCTTCCCAGATTGAACTAGG - Intergenic
996636721 5:125699502-125699524 AAATGTGGCCAGTTTGAATTGGG - Intergenic
997153604 5:131527003-131527025 CAAGCTAGGCATTTTGAATTTGG + Intronic
1000126265 5:158246820-158246842 CAAGCTGCCCATTTTGAATTTGG + Intergenic
1000443199 5:161286987-161287009 AAAGCTGGCCAGTTGGTGTTGGG - Intergenic
1001690341 5:173628321-173628343 AAAGCTGGAGAGTTGGAATTTGG + Intergenic
1002573924 5:180161060-180161082 CAGGCTGGCCTGTGTGAATGGGG - Intronic
1002601545 5:180356655-180356677 CCAGCTGGGCAGTTTGTGTTGGG - Intergenic
1003087325 6:3070244-3070266 TAAGCTGCCCAGTTTGAAAGAGG - Intronic
1004313925 6:14570182-14570204 CACGCTGGCCAGGCAGAATTGGG - Intergenic
1004432962 6:15562875-15562897 GAAGGTGGCCAGTATGGATTTGG - Intronic
1006575897 6:35045615-35045637 CAAGCTGGACACCATGAATTAGG + Intronic
1009684645 6:66941302-66941324 AAAGCTGGCAAGGTAGAATTAGG + Intergenic
1012481293 6:99670056-99670078 GAAGCAGGACAGTTTGAGTTAGG + Intergenic
1014465676 6:121753839-121753861 GAAGGTGGCCTGTTTGCATTTGG + Intergenic
1016517862 6:144916345-144916367 CAATCTTCCCAGTTTGAATCTGG + Intergenic
1020357149 7:7290050-7290072 CAAGCAGGCCATTTTGGATGTGG + Intergenic
1021773105 7:24024879-24024901 CCAGCTGGGCAGATTGCATTAGG + Intergenic
1023631194 7:42166079-42166101 CAGGCTGGGCAGTTTGGAGTTGG - Intronic
1024966197 7:55023976-55023998 CAAGCTGGCCAGTTTGAATTTGG + Intronic
1027362033 7:77418865-77418887 CATGCAAGCCAGTTTGAGTTGGG + Intergenic
1027561872 7:79740620-79740642 AAAGCTGGCCATTTTGAAAGAGG + Intergenic
1028057394 7:86263300-86263322 CAATTTGGCCATTTTTAATTTGG - Intergenic
1028473866 7:91232850-91232872 CAGGCTGGCCAGTGGGAATTTGG + Intergenic
1029885137 7:103861532-103861554 AAGGCTGGCCATTTTGAATCAGG + Intronic
1044572228 8:93733715-93733737 GAAGGTGGCAAGTTTGATTTTGG - Exonic
1048342297 8:133549626-133549648 CAAACTTGTCAGTTGGAATTTGG - Intronic
1059660084 9:116391793-116391815 CATGGTGGCCAGTTTACATTTGG - Intronic
1059911425 9:119048579-119048601 CAAGCTGGACAGTTAGAAAGTGG - Intergenic
1061275252 9:129566502-129566524 CAAGCTGGCCTGTTGGGACTGGG - Intergenic
1193333422 X:80260602-80260624 CCAGCTGGCCAGCGAGAATTGGG - Intergenic
1194444962 X:93975985-93976007 GAAACTGGGCAGTTTGGATTAGG - Intergenic
1196531720 X:116795263-116795285 CACGCTGCCCACTTTTAATTGGG + Intergenic
1196866087 X:120072565-120072587 CCCGCTGGCCAGGCTGAATTTGG - Exonic
1196877009 X:120163716-120163738 CCCGCTGGCCAGGCTGAATTTGG + Exonic
1197058245 X:122146210-122146232 CAAATTGCCCAGTTTTAATTTGG - Intergenic
1198298900 X:135314689-135314711 CAACCTGCCCAGCTTGAATCAGG - Intronic
1200272613 X:154700003-154700025 CAAGCGGCTTAGTTTGAATTTGG - Exonic
1200409569 Y:2847912-2847934 CAAGCTGCCCAGTATCAATGAGG - Intronic
1201557672 Y:15281654-15281676 CAAGCTGGCCTCTGTTAATTAGG + Intergenic