ID: 1024966349

View in Genome Browser
Species Human (GRCh38)
Location 7:55025402-55025424
Sequence AGGCTTCTCACTTGGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024966344_1024966349 -8 Left 1024966344 7:55025387-55025409 CCCAGATTGACACCCAGGCTTCT 0: 1
1: 0
2: 8
3: 44
4: 318
Right 1024966349 7:55025402-55025424 AGGCTTCTCACTTGGAAGCCTGG 0: 1
1: 0
2: 0
3: 18
4: 195
1024966345_1024966349 -9 Left 1024966345 7:55025388-55025410 CCAGATTGACACCCAGGCTTCTC 0: 1
1: 0
2: 0
3: 18
4: 184
Right 1024966349 7:55025402-55025424 AGGCTTCTCACTTGGAAGCCTGG 0: 1
1: 0
2: 0
3: 18
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024966349 Original CRISPR AGGCTTCTCACTTGGAAGCC TGG Intronic
901212377 1:7533950-7533972 AGGCTTCTTCCCTTGAAGCCAGG + Intronic
901718798 1:11178383-11178405 AGGCTCCTCAGTTGCAAACCTGG - Intronic
903222252 1:21875437-21875459 AGGCTTCTTTCTAGGGAGCCTGG + Intronic
903832458 1:26183294-26183316 AGGCCTCTCACCTGCAAGCCAGG + Intronic
904525077 1:31127452-31127474 AAGCTAATCACTTGGAAGCCAGG + Intergenic
905673458 1:39808304-39808326 GGGCTCCTCACTTGGCAGACGGG - Intergenic
905721885 1:40210763-40210785 AGGCTTCTAGCTTGGGAGACTGG + Intronic
906369020 1:45236537-45236559 AGGCTTCTGCCTGGGAACCCAGG - Intronic
906691911 1:47798398-47798420 AGGCCTTCCCCTTGGAAGCCTGG - Intronic
907108556 1:51905999-51906021 AGGCTTTGCACTTGGAATCTAGG + Intergenic
907401228 1:54226155-54226177 AGGATTCTCACTGGGAAGACTGG + Intronic
908260538 1:62336768-62336790 AGGCTCCTCCCCTGGGAGCCTGG + Intergenic
908493518 1:64670573-64670595 GGACTTCTCACTTGGAACCTTGG - Intronic
910702458 1:90090975-90090997 AGGGCTCTGACTTGGAAGTCAGG - Intergenic
911587607 1:99708912-99708934 TGAATTCTCACTTGGAAGACTGG - Exonic
911797123 1:102089427-102089449 AGGCTTTTCATTTGAAAGTCAGG - Intergenic
919463667 1:197908028-197908050 GTGCTTCCCACTTGGAAGACTGG + Intergenic
920446480 1:206022318-206022340 AGGGTGCTCACCAGGAAGCCAGG + Intronic
920788433 1:209064996-209065018 GGGCTTCTCAGCTGGAACCCAGG - Intergenic
921128039 1:212195565-212195587 AGGCTTCTGTCTTGACAGCCAGG - Intergenic
921640304 1:217545037-217545059 AGCCTTCTCAATTGGCAGACAGG + Intronic
922157194 1:223049666-223049688 AGGCATGTCACCTGGAAGCCAGG + Intergenic
922563268 1:226584535-226584557 AGGCTTATGGGTTGGAAGCCAGG - Intronic
1066123759 10:32318660-32318682 AGGCTTCTGACTTGGGTGACTGG - Intronic
1066180112 10:32953754-32953776 AGGCTTCTCGATTGGGAGACAGG - Intronic
1066260319 10:33723574-33723596 AGGTTTATCACTAGGCAGCCAGG - Intergenic
1067694020 10:48522713-48522735 AGGCTTCATTCTTGGAAGCAGGG - Intronic
1068251368 10:54446068-54446090 AGGCTTTTTACTTTTAAGCCAGG - Intronic
1070458560 10:76642320-76642342 AGGCTGCTCAAGGGGAAGCCAGG + Intergenic
1070653623 10:78255654-78255676 CGGCTTCTAACTTGGAAACTGGG - Intergenic
1072791343 10:98320538-98320560 AGGGTTATCACTAGGAACCCAGG + Intergenic
1073604101 10:104876550-104876572 AGGCTTCTAACTTTCAACCCAGG - Intronic
1076624325 10:131812212-131812234 AGGGTTCTCACGTGGACGCTAGG - Intergenic
1076836972 10:133026006-133026028 TGGCTTCTCACTCAGAAGCAAGG - Intergenic
1079251537 11:18791306-18791328 GGGCTTGTCGCTTGGTAGCCGGG - Intronic
1082616847 11:55371381-55371403 AGGCTTCTCTCTGGGATTCCAGG + Intergenic
1083443617 11:62692589-62692611 AGGCTTCTCAGGTAGAATCCTGG + Intronic
1083471996 11:62890189-62890211 AGAATTCTTACTTGGAAGTCTGG - Intergenic
1085098355 11:73779333-73779355 ATGATTCTCACTTGGGAGCTGGG - Intergenic
1085636339 11:78162300-78162322 AGTCTCCTCACTTGGAAAACTGG + Intergenic
1085636604 11:78164033-78164055 AGTCTTGGCACTGGGAAGCCTGG + Intergenic
1085863577 11:80261958-80261980 AGGCTTGTTACTTGCCAGCCGGG + Intergenic
1087987186 11:104697361-104697383 ATGCTTCTTACGTGGAAGCTGGG - Intergenic
1087987267 11:104698190-104698212 ATGCTTCTTACATGGAAGCTGGG + Intergenic
1088782776 11:113152131-113152153 AGGCATCTCTCATGGGAGCCTGG + Intronic
1089653197 11:119928441-119928463 AAGCTCCTGACTTAGAAGCCAGG + Intergenic
1092702583 12:11248568-11248590 AGGGTTCTCACTTCAAAGCATGG - Intergenic
1092821084 12:12354081-12354103 AGGCTTCTGGCTTGGGAGCCTGG + Intergenic
1094220251 12:27985388-27985410 TTGCTTCTCTGTTGGAAGCCCGG - Intergenic
1099475609 12:83104385-83104407 AGGCTTCTCTCTGGGCACCCAGG + Intronic
1103235104 12:119365969-119365991 AGGCTTCCCACCTGGAGTCCTGG + Intronic
1104021705 12:124996435-124996457 CGGCTACTCACTTGTAATCCCGG - Intronic
1104208147 12:126660700-126660722 AGGTTTCTCAGTTGTAAGCAAGG + Intergenic
1106760392 13:32862031-32862053 AGGCTTCTAACTTGGATGACTGG - Intergenic
1107560176 13:41551188-41551210 GGGCTTCTCACATGGAGGCTCGG + Intergenic
1109268091 13:60223964-60223986 AGGCATTCCACTTGGAAGCCTGG - Intergenic
1111432981 13:88167833-88167855 AGGAATCTCACTTGGGAGGCAGG + Intergenic
1111458038 13:88508881-88508903 AGGCTTCTGTCTGGGAACCCAGG + Intergenic
1114667597 14:24389203-24389225 AGGCTTCACACTTGGGAGTGAGG - Intergenic
1116123916 14:40756909-40756931 AACCTTCTCACTTGTAAGCAGGG - Intergenic
1116870609 14:50066157-50066179 AGGCTTGTGACTTTGAAACCTGG + Intergenic
1117209555 14:53481417-53481439 AGGCTTCTGTCTGGGCAGCCAGG + Intergenic
1120873114 14:89355751-89355773 ACACTTCTTACTGGGAAGCCGGG + Intronic
1123976467 15:25558742-25558764 AGGCTTCTCACCTCTTAGCCTGG + Intergenic
1124652842 15:31485746-31485768 AGGCTCATCCCCTGGAAGCCAGG - Intronic
1126894259 15:53241444-53241466 AGGCTTCTCATCTGTATGCCTGG + Intergenic
1128311817 15:66635670-66635692 AGGCTTCTCATATGGCAGTCAGG - Intronic
1128862668 15:71086962-71086984 AGGCTTCCATCTTGGAAGTCTGG - Intergenic
1130012597 15:80163252-80163274 GCGCATCTCACGTGGAAGCCTGG - Intronic
1133328928 16:4959146-4959168 AGCCTTCTCAATTTGAAGGCTGG + Intronic
1134071934 16:11265660-11265682 AGGTTTCCTACTTGGAAGCAGGG + Intronic
1135669197 16:24360725-24360747 AGGGTTCTAACTTGGATGCTTGG - Intronic
1136003464 16:27313492-27313514 ACCACTCTCACTTGGAAGCCGGG + Intergenic
1136501176 16:30670264-30670286 AGGCTTCTCCCTGGGAAGGTGGG + Exonic
1137619995 16:49869801-49869823 AGCCTTCTTCCCTGGAAGCCAGG - Intergenic
1141478805 16:84292591-84292613 AGGCTGCTTATTTAGAAGCCAGG - Intergenic
1142495473 17:304300-304322 AGGTCTCTCACCTGGAAGTCGGG - Intronic
1143839797 17:9723166-9723188 GGGCTTCTCACCTGCAACCCTGG - Intronic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1144804441 17:17955131-17955153 AGTCTTCTCACTTGTCAGCTGGG - Intronic
1145003020 17:19318768-19318790 GGGGTTCTCACGTGGAAGCCTGG + Intronic
1146826938 17:36031295-36031317 ATACTTCTCTCTTGGCAGCCAGG + Intergenic
1147832918 17:43309763-43309785 AGTGTGGTCACTTGGAAGCCTGG + Intergenic
1149649961 17:58270661-58270683 AGGCTTCCCTCCAGGAAGCCAGG + Exonic
1150220991 17:63495841-63495863 AGGCCTCTCACTTTGAATGCTGG - Intronic
1151662425 17:75525814-75525836 ACGCATCTCACCTGGAACCCCGG - Exonic
1151965611 17:77429716-77429738 AGGATGCTCACTTGAAAACCAGG - Intronic
1152376490 17:79921320-79921342 TGGCTTCTAACCTGGAACCCGGG + Intergenic
1153002498 18:468495-468517 AGACTTCTGAATTGGAAGCATGG - Intronic
1154312020 18:13274174-13274196 AGCCTTCTTTCTTGGAGGCCTGG + Intronic
1155436727 18:25820124-25820146 AGGCTTCTCCGTTAGCAGCCAGG + Intergenic
1156195065 18:34765473-34765495 AGTTTTCTCACTTGGAAGATGGG - Intronic
1156488003 18:37478793-37478815 GGGCTTCTCTCTTGGAACCTTGG + Intronic
1157247708 18:46069121-46069143 AGGCTTCTCACTTGGGTGTGAGG - Intronic
1157546797 18:48552280-48552302 TGTCTTCTCACTGGCAAGCCTGG - Intronic
1157547093 18:48554275-48554297 TGTCTTCTCACTGGCAAGCCTGG - Intronic
1158546042 18:58397979-58398001 TGGCTTCTCACATGCCAGCCAGG - Intronic
1159759555 18:72407970-72407992 AGGCTTCTGCCTTGGCACCCAGG - Intergenic
1161686228 19:5704009-5704031 AGGCCTCTCACATGGCAGCAGGG + Intronic
1162124675 19:8493130-8493152 AGGGCTCTGACTTGGGAGCCTGG - Intronic
1163089549 19:15010366-15010388 CGCCTTCACACTTGGAAGCTTGG - Intronic
1163531808 19:17854289-17854311 AGGTGTGTCACTAGGAAGCCGGG + Intergenic
1166349199 19:42186819-42186841 ACGTTTCTCACTTGGATGCCCGG + Intronic
1166587293 19:43960849-43960871 AGGCTTCTGACTGGGATCCCAGG - Intronic
925767564 2:7251363-7251385 AGGTTTCTCATTTGAAAGACTGG + Intergenic
926056598 2:9777429-9777451 AGGCTTCTCACTTCTAAGTGGGG + Intergenic
927089608 2:19700562-19700584 AGGCCTCTCACTTTGAGCCCAGG + Intergenic
928109564 2:28495672-28495694 AGCTTTCTCAGTTGTAAGCCAGG - Intronic
931834067 2:66080836-66080858 AGTCTTCTCTGTTGGTAGCCTGG - Intergenic
932885457 2:75545454-75545476 AGGCTTCTCTGTGGGAAGCAGGG + Intronic
933063489 2:77767737-77767759 AGTCTGCTCCCTTGGGAGCCTGG + Intergenic
936898324 2:117454821-117454843 AGGCTTCTGCCTGGGAATCCAGG - Intergenic
942305224 2:174600540-174600562 AGGCCTTTTACTTGCAAGCCTGG + Intronic
944493017 2:200277538-200277560 AGGCTTCTTAGTTGGAGGCAAGG - Intergenic
945000056 2:205339884-205339906 AGGCCTGTCCCTTGGAAGACAGG + Intronic
946662774 2:222019098-222019120 AGACTTCACCGTTGGAAGCCTGG + Intergenic
948357565 2:237392040-237392062 AGGCCTGTCATTTGGAAGCAGGG + Intronic
948556343 2:238813931-238813953 ACCCTGCCCACTTGGAAGCCAGG + Intergenic
1170362329 20:15559887-15559909 AGCCTTCTAATTTGGAAGACTGG - Intronic
1170719094 20:18859681-18859703 AGGCTTCTGCCTTGGCACCCAGG - Intergenic
1171063405 20:21988326-21988348 AGGAGTCTCACTGGGAATCCAGG + Intergenic
1174277834 20:49416715-49416737 AGGCTGCTCAAGTGGAACCCAGG - Intronic
1175888602 20:62306102-62306124 AGGTCCCTCACCTGGAAGCCAGG + Intronic
1175983661 20:62753756-62753778 CGGTTTCTCCATTGGAAGCCGGG + Intronic
1176120757 20:63453557-63453579 GGGCTCCTGACTGGGAAGCCAGG - Intronic
1177395052 21:20523389-20523411 TGGCTTCTCTCTAGTAAGCCTGG + Intergenic
1180624604 22:17185890-17185912 AGGCTGTTCACATGGAGGCCGGG - Intronic
1181870809 22:25897871-25897893 AGGCTTGTCACTTGGGATTCCGG + Intronic
1182874222 22:33676468-33676490 TGGCTTTTCACTTAGAAGTCTGG - Intronic
1183320328 22:37161489-37161511 AGGCTTCTGATTGGGCAGCCTGG - Intronic
1183515958 22:38266178-38266200 AGCCTCCTCTCTGGGAAGCCAGG - Intronic
953322294 3:41983310-41983332 GGGCTTCTCACTTGTCAGACGGG + Intergenic
953604984 3:44406270-44406292 AGGCTTTTCACTTCCAAGCATGG + Intronic
953658245 3:44871157-44871179 AGGGTGCTCAGGTGGAAGCCTGG - Intronic
956238438 3:67102882-67102904 AGGCATCTCACATGGTAACCAGG - Intergenic
958781563 3:98549538-98549560 AGGCTTCTCCACTGAAAGCCAGG + Intronic
958893842 3:99808690-99808712 GGGATGCTCACTTGGAACCCAGG - Intergenic
961507254 3:127378259-127378281 AGGCTTGTCTGTGGGAAGCCAGG - Intergenic
962267148 3:133951960-133951982 AAGCTGCTCCTTTGGAAGCCAGG - Intronic
962626299 3:137229078-137229100 AGGCTCCTTGCTTGGATGCCTGG - Intergenic
965107188 3:164371834-164371856 AGACTTCTAAATTGGAAGTCAGG + Intergenic
965189639 3:165511751-165511773 AAGATTCACACTTGGAAGCTGGG - Intergenic
966851666 3:184168641-184168663 TGACTTCTCTCTTGGAAGGCTGG + Intronic
967037164 3:185656507-185656529 AGACTTCTCATTTGGAATTCTGG + Intronic
968123650 3:196143243-196143265 AGTCTTCTCTCTTGGAAAACCGG - Intergenic
968759335 4:2433948-2433970 AGGCTTCTCAGATGGATGTCGGG - Intronic
971062643 4:22990079-22990101 AGGCTTCTCGTATGGAAGCCAGG - Intergenic
980323144 4:131305242-131305264 AGGATTCTAAATTGGAAGACAGG + Intergenic
981064346 4:140466079-140466101 AGGCTTATCACTGGGAGGCGAGG - Intronic
985072082 4:186176240-186176262 TGGCTTCACACTTGGAAGGATGG + Intergenic
988421833 5:31015263-31015285 TGGCTCCTCAGTTGGAAGCCAGG + Intergenic
990703627 5:58502271-58502293 GAGCTTCTCACTCAGAAGCCAGG - Intergenic
991562040 5:67964196-67964218 AGGGTTGTCCCTTGGGAGCCTGG - Intergenic
992089739 5:73306385-73306407 TGGCTTCTCTCTTGGCTGCCAGG - Intergenic
992983499 5:82202631-82202653 GGGCTTCTCACTAGAAAGACAGG + Intronic
993661861 5:90647399-90647421 AGGCTTCTCTCTTGGAGGGCAGG + Intronic
995536926 5:113145880-113145902 AGGCTTCTCAGTTAGAGGCAGGG - Intronic
996038254 5:118782469-118782491 AGTCTTCTCACTTGTAAAACTGG - Intergenic
996909379 5:128637736-128637758 TGACTTCTGACTTGGTAGCCAGG + Intronic
997234566 5:132265398-132265420 AGGGTACCCACTTGGGAGCCTGG + Intronic
997340491 5:133140948-133140970 GGGCTTCTCACTGGGAAGGCAGG + Intergenic
998169203 5:139862340-139862362 AGCTTTCTCACTGGGAAGCATGG + Intronic
1000063162 5:157673870-157673892 AGGCGAATCACTTGGAAGTCAGG - Intronic
1001489927 5:172148165-172148187 AGGCTTCTCATCTGGACGTCGGG - Intronic
1005343697 6:24868367-24868389 AGGCTCCCCACTTGGAAGAGAGG + Intronic
1007095782 6:39212059-39212081 AGGCAGATCACTTGGAAGTCAGG + Intronic
1008236509 6:49057777-49057799 AGGCTTCTGCCTGGGAACCCAGG + Intergenic
1010409085 6:75540091-75540113 AGGCTGCTTACAAGGAAGCCAGG - Intergenic
1011446301 6:87444903-87444925 AGGCTCACCACTTGTAAGCCTGG + Intronic
1011503260 6:88013702-88013724 AGGCTTCTGACTTGCTAACCAGG - Intergenic
1014255522 6:119157153-119157175 GGGCTTCTCATTTGGAGGCAGGG + Intergenic
1015819806 6:137248686-137248708 AAGTTTCTCACTGGGAAGTCAGG - Intergenic
1018239732 6:161761612-161761634 GGTTTTCTTACTTGGAAGCCAGG - Intronic
1019035162 6:169048480-169048502 AGGCTCCTCCCTTGGAAGCGAGG - Intergenic
1019107194 6:169677971-169677993 AGGCTTCTGCCTTGGCACCCAGG - Intronic
1019528727 7:1493260-1493282 TGGCTTCTCACTGGGAAACAGGG + Intronic
1020027244 7:4907712-4907734 AGGCTTCCCACCTGGGAGTCTGG - Intronic
1021168891 7:17373986-17374008 AGGCTTTTCACCTGGCAGCTTGG - Intergenic
1022081942 7:27031046-27031068 AGGCTTCTCACTTGGTGGACTGG + Intergenic
1022323528 7:29309275-29309297 AGGCTGCTCATCTGGAAGACTGG - Intronic
1023899878 7:44467487-44467509 TGGGTTCTAACTTGGCAGCCTGG - Intronic
1024227125 7:47334246-47334268 AGGCTGCATGCTTGGAAGCCAGG + Intronic
1024966349 7:55025402-55025424 AGGCTTCTCACTTGGAAGCCTGG + Intronic
1032128018 7:129208795-129208817 AGCCTTCTCACTCAGCAGCCCGG - Exonic
1033519948 7:142150291-142150313 ATGCTTCTCACTTGAGAGTCTGG - Intronic
1033784832 7:144717975-144717997 AGGCTTCTGCCTGGGCAGCCAGG - Intronic
1035407237 7:158607149-158607171 TGGCTTCCCACTCAGAAGCCAGG + Intergenic
1039358077 8:36843308-36843330 TGTCTTCTCACTGGGAAGTCTGG + Intronic
1041005063 8:53489730-53489752 AGGCTTCTGGCTAAGAAGCCTGG - Intergenic
1043094640 8:75951230-75951252 AGGTTTCTAACTTGGGATCCTGG + Intergenic
1043583341 8:81738404-81738426 AGCTCTCTCACTTTGAAGCCTGG + Intronic
1043609960 8:82050316-82050338 AGGTTATTCCCTTGGAAGCCAGG - Intergenic
1046111954 8:109736229-109736251 AGGCTTCTCCTTTTGAAGACTGG + Intergenic
1046263845 8:111805785-111805807 AGGTTGCTCACCTGGAAGACAGG + Intergenic
1046709863 8:117498981-117499003 AGGCTTTTCGATTGGAAGCTGGG - Intergenic
1047020944 8:120774575-120774597 AGGTTTCTAGCTTGGGAGCCTGG + Intronic
1048955285 8:139530822-139530844 AGGCTTGTCACTGGGTAGCAAGG + Intergenic
1049057169 8:140246529-140246551 AGGGTTCTCATATGGAAGACAGG - Intronic
1049302234 8:141877699-141877721 AGGATTCTCTCTTGGAACCTCGG - Intergenic
1056062717 9:82900594-82900616 AGGCTTCACACAAGGAAGCAAGG + Intergenic
1056109241 9:83378203-83378225 AGACTTCTCACTTGGTACCATGG + Intronic
1056825435 9:89873485-89873507 GCTCTTCTCACTTGGAAGGCTGG + Intergenic
1061238944 9:129358098-129358120 AGCCCTCTCACCTGGAAGCTTGG - Intergenic
1185794918 X:2956688-2956710 AGGCTGATCACTTGGAGGTCAGG - Intronic
1186308407 X:8290069-8290091 AGGTTTCTCAGGTGGTAGCCAGG - Intergenic
1186920236 X:14270535-14270557 AGACTTTTTACTTTGAAGCCAGG - Intergenic
1191979231 X:66907679-66907701 AGAATTCTCACCTGGAAGTCAGG - Intergenic
1193265592 X:79464484-79464506 GGGCTTCTCCCGTGGAAGCCTGG + Intergenic
1194019494 X:88669152-88669174 AGGCTTCTGACTAGGAATGCAGG + Intergenic
1194866541 X:99075750-99075772 GGGTCTCTCACTTGGAAGTCTGG - Intergenic
1196151303 X:112377713-112377735 AGGCTGCTTACATGGTAGCCTGG - Intergenic
1197049910 X:122045730-122045752 GGGCTTCTCCCATGAAAGCCTGG - Intergenic
1199714079 X:150493613-150493635 AGGGTTGGCTCTTGGAAGCCAGG - Intronic
1199954966 X:152735242-152735264 AGGCTTCTCACCTGGATGCTTGG - Exonic