ID: 1024967453

View in Genome Browser
Species Human (GRCh38)
Location 7:55036707-55036729
Sequence TTGCAGTAACAGTAAGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024967453_1024967455 10 Left 1024967453 7:55036707-55036729 CCCTCATCTTACTGTTACTGCAA 0: 1
1: 0
2: 2
3: 11
4: 200
Right 1024967455 7:55036740-55036762 ATTACAAATTATATAAAAATAGG 0: 1
1: 0
2: 6
3: 148
4: 1585

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024967453 Original CRISPR TTGCAGTAACAGTAAGATGA GGG (reversed) Intronic
902718379 1:18288386-18288408 TTCCAGAGTCAGTAAGATGATGG - Intronic
905952196 1:41961243-41961265 ATGCAGTTACAGTCTGATGATGG - Intronic
906721917 1:48012958-48012980 TAGCAGCAAGAGTAAGAAGAGGG - Intergenic
907548287 1:55282286-55282308 TTGAAGTGACAGTAAGAAGAGGG + Intergenic
909581423 1:77240020-77240042 TTTCAGTAATAGGAAGTTGAGGG - Intergenic
911040939 1:93590137-93590159 TGATAGTAACTGTAAGATGAGGG - Intronic
914495144 1:148189296-148189318 TTGCAGTTAAAATAAGAGGAAGG + Intergenic
916086396 1:161273133-161273155 TGGCAGTATCACCAAGATGATGG + Intronic
916197953 1:162242578-162242600 GTGCAGTTACAGTAAGATGTTGG - Intronic
918710063 1:187715807-187715829 TTGAAGTAACACTGAAATGAGGG - Intergenic
919600937 1:199621481-199621503 TTGCAGTTACAGTGAGAAGTAGG - Intergenic
1063979639 10:11443412-11443434 TTGCAGTAACAGTAACAGCTGGG - Intergenic
1064989484 10:21243662-21243684 TTTCAGTAACTGTAAGAGGGAGG + Intergenic
1067932576 10:50577551-50577573 TTGCATTAAAATTAAGAGGAAGG - Intronic
1068583510 10:58770295-58770317 TTTGAGAAACAGTGAGATGATGG + Intronic
1072372889 10:94783326-94783348 TTGCAGTGAGAGTCAGAAGAGGG + Intronic
1072387988 10:94951775-94951797 TTGCAGTGAGAGTCAGAGGAGGG + Intronic
1072932648 10:99680264-99680286 TTGCAGTAGCAGCAAGAAGAGGG - Intronic
1073768781 10:106712024-106712046 TTGCAGTAACAGCAAGACTCAGG - Intronic
1073815858 10:107205879-107205901 TTACAGTAACCGTACGAGGAGGG - Intergenic
1079662460 11:23056761-23056783 TTGCAGTAACTGTTATTTGATGG + Intergenic
1079764750 11:24377978-24378000 TAGCTGTAAGAGAAAGATGAAGG + Intergenic
1080223163 11:29930488-29930510 CCGCAGTGACAGTGAGATGATGG - Intergenic
1081240735 11:40703276-40703298 TTGCCATAAAAGTTAGATGAGGG - Intronic
1081541643 11:44038906-44038928 TTGCAGTCTCTGTAAGGTGAAGG + Intergenic
1083537125 11:63479868-63479890 TGGCAGTAACAGTAAGATTATGG + Intronic
1085914379 11:80867566-80867588 TTGCAGTTCCAGTAAGCTCAAGG + Intergenic
1087280537 11:96204698-96204720 TTGCAGTCACATTATGTTGAAGG + Intronic
1087716577 11:101615018-101615040 TAGCAGCAACAGTAAGACAACGG - Intronic
1088042628 11:105406244-105406266 TTGGAGAAAAATTAAGATGAAGG + Intergenic
1091306887 11:134541997-134542019 ATGCAGTAAGAGGAAAATGAAGG - Intergenic
1091598398 12:1897515-1897537 TATCAGTAAAAATAAGATGATGG + Intronic
1091968344 12:4764367-4764389 TTCCAGTAGCAGTGAGAAGATGG - Intronic
1093700491 12:22214821-22214843 TTGCAGTAACTCTATGAGGAAGG + Intronic
1096590257 12:52653797-52653819 TTGCAGTAAAAGAATGCTGAAGG + Intergenic
1097303450 12:58043158-58043180 TGTCAGTAGCAGTAGGATGATGG + Intergenic
1101537832 12:105635857-105635879 TTGCAGTGAAAATAAGATGGGGG - Intergenic
1101616480 12:106342895-106342917 TTGCAGTATCAGAAGGAAGAGGG + Intronic
1102442869 12:112977092-112977114 TTGCAGTAAAAGTTGGATAAGGG + Intergenic
1103504440 12:121432256-121432278 TTGCAGTAAGATTATGAAGAGGG - Intronic
1103660643 12:122512883-122512905 TAGCAGTAACAATAAAATGTAGG + Intronic
1106500482 13:30323630-30323652 TTGCAGCAGCAGTAGGAGGAGGG + Intergenic
1107665169 13:42680966-42680988 TGACAGTAACATTAAGAGGAAGG - Intergenic
1107700414 13:43041571-43041593 TTGCAGTAACAGTGAGGTGAGGG + Intronic
1107875160 13:44783787-44783809 TTGCAGTAACCAAAAGAGGAAGG + Intergenic
1110068802 13:71146108-71146130 TTGCAAGAACAGTAAAATAAAGG - Intergenic
1110265649 13:73534547-73534569 TTCCAGAAACATTAAGAAGATGG - Intergenic
1111051832 13:82892844-82892866 ATGCAGTAATAATTAGATGATGG + Intergenic
1111979053 13:94997854-94997876 TTGCAGTTAGGGAAAGATGATGG - Intergenic
1112166909 13:96929339-96929361 TAGCAGTACCGGTAAGAAGAAGG - Intergenic
1114882038 14:26798249-26798271 TGGCAGTAACAGTGAAATGGGGG + Intergenic
1115372808 14:32637702-32637724 GTGCATTAACAATGAGATGAGGG + Intronic
1116907659 14:50420704-50420726 TTTCACTAACAGGAAGAGGATGG + Intronic
1117242586 14:53849803-53849825 TTGCAATAAAGGTTAGATGAAGG - Intergenic
1117448925 14:55831930-55831952 TTCCAGTAACAGTATGAAGGTGG + Intergenic
1117613433 14:57507552-57507574 TTGCAGAAGCAGGAAGATGATGG - Intergenic
1122667207 14:103339166-103339188 TTGCAGAAAAAGAAAGAAGAGGG + Exonic
1123483784 15:20664471-20664493 TGGCAGAAATAGTAAGATTAAGG - Intergenic
1124206437 15:27724696-27724718 TTGCAGTCACTGTAAGACTAGGG - Intergenic
1127603406 15:60561873-60561895 TTCCAGTAACATGAAGATAATGG - Intronic
1128130257 15:65222544-65222566 GTGAAGTAGCAGAAAGATGAAGG - Intergenic
1128375540 15:67072405-67072427 TTGCAATTACAGGAAGCTGAAGG - Intronic
1128436710 15:67658604-67658626 TTGCAGTAGCAGTAAGTATATGG + Exonic
1132128926 15:99256051-99256073 TTGGAGTTACTGAAAGATGAGGG + Exonic
1137344451 16:47642615-47642637 TTGCTATAACAGAAAAATGAAGG + Intronic
1142284236 16:89165254-89165276 TGGTAGGAACAGTAAGATGGTGG + Intergenic
1147859864 17:43512664-43512686 TTTCAGGACCAGTAAGATGCTGG + Intronic
1153343964 18:4006529-4006551 TTGCAGTCACAGTTGGAGGAGGG + Intronic
1153954105 18:10081426-10081448 GTGCAGTAACAGGAAGATTGTGG + Intergenic
1154496907 18:14968098-14968120 TAGGAGAAACAGGAAGATGATGG - Intergenic
1157188021 18:45557275-45557297 TTGCAGAAACAGTTAGAGAATGG - Intronic
1168400367 19:56082163-56082185 TGACAGGAACTGTAAGATGAAGG - Intergenic
1168590344 19:57629016-57629038 TTGCAGTAAAATTAAGGGGAAGG + Intergenic
925112485 2:1347860-1347882 TTCCAGGAACATGAAGATGATGG - Intronic
925478583 2:4245884-4245906 TTTCACTAACATAAAGATGAAGG + Intergenic
925481922 2:4285094-4285116 TTGCAGATAGAGTAAGATTATGG + Intergenic
926772348 2:16389626-16389648 CAGCAGGAAGAGTAAGATGAAGG - Intergenic
930149659 2:48045530-48045552 ATGCAGTTACAGAGAGATGACGG + Intergenic
930315588 2:49793401-49793423 TTTCAGTAACATTAACATGTGGG - Intergenic
930461873 2:51691339-51691361 TTGCAATTACAGTGATATGAAGG - Intergenic
930590119 2:53317039-53317061 TTTCTGTAACAGTAAATTGAAGG - Intergenic
930705774 2:54503366-54503388 TTGCAGTCAGAGCAAGCTGAGGG + Intronic
931902478 2:66805177-66805199 TTGCAATAAAGATAAGATGATGG + Intergenic
934913158 2:98277269-98277291 CTGCAATCACAGTAACATGAGGG - Intronic
936384908 2:112020632-112020654 CTGCAGTAAGAGCAAGATGCTGG - Intronic
937107652 2:119333122-119333144 TTGCCTTAACAGTATGTTGAAGG + Intronic
938299555 2:130200453-130200475 TTCCAGGAACAGGAAGATAATGG + Intergenic
938457154 2:131474033-131474055 TTCCAGGAACAGGAAGATAATGG - Intronic
939394183 2:141607505-141607527 TTACAGTGAAAATAAGATGAGGG - Intronic
940756235 2:157686159-157686181 TTTCCTTAACAGTAAAATGAGGG - Intergenic
942342552 2:174963205-174963227 TGGCAGTAACAAAAATATGATGG + Intronic
945478846 2:210320928-210320950 TTGCAGTAAAAATGAGATGCTGG - Intergenic
946864330 2:224029288-224029310 TTGCTCTAACAGTGAGATTAGGG - Intronic
947070455 2:226282402-226282424 TTGCAATAGCCATAAGATGAAGG + Intergenic
948739011 2:240030821-240030843 TTGCAGGAACCCTCAGATGAAGG - Intergenic
1169538043 20:6567728-6567750 GTGCAGTTACAATAAGAAGACGG - Intergenic
1171146867 20:22792254-22792276 ATGCAGTTAGAGTAGGATGAGGG - Intergenic
1173244808 20:41329276-41329298 TTGCAGTAACACTGAGACGATGG + Intergenic
1174079291 20:47959634-47959656 TGGCATTAAAAGTAAAATGAAGG - Intergenic
1177617657 21:23544716-23544738 TTGCAGTTCAAGTAAGATTAAGG + Intergenic
1177931037 21:27283923-27283945 TTATAATAACACTAAGATGAAGG - Intergenic
1178075010 21:29007162-29007184 TTGCAGCATCACTAAAATGAGGG + Intronic
1178558284 21:33613801-33613823 TCTGAGTGACAGTAAGATGATGG + Intronic
1178724929 21:35042852-35042874 TTGCAGTGACAGAAAGAGTAAGG - Intronic
1181180431 22:21064116-21064138 TTCCAGAAACAGGAAGATAATGG - Intronic
1184023903 22:41839503-41839525 TTGCCAGAACAGTCAGATGAGGG + Intronic
1184339219 22:43876834-43876856 TTGCAGTGAGATTTAGATGATGG + Intergenic
1185260919 22:49862606-49862628 CTGCTGTAACAGTAAGATTGAGG - Intronic
949959360 3:9299437-9299459 TTGCAGTGGCAGTAACATGGTGG - Intronic
951082053 3:18464188-18464210 TTGCAGTACCTGTAAGAGGAAGG + Intergenic
951245393 3:20335541-20335563 TTGTAGGAACAGACAGATGAAGG - Intergenic
952985273 3:38773787-38773809 TAACTGTAACAGGAAGATGAGGG + Intronic
953950042 3:47182379-47182401 TTCCAGGAACAGGAAGATAATGG - Intergenic
955887095 3:63612072-63612094 TTACAGTAACACTAAAATGTAGG + Intronic
956253423 3:67258710-67258732 ACACAGTAACAGTGAGATGATGG + Intergenic
956963825 3:74435147-74435169 TTCCAGTAAAATTAATATGATGG - Intronic
960241720 3:115350361-115350383 TTGTAGAGACTGTAAGATGAGGG + Intergenic
961588225 3:127953237-127953259 GGGCATTAACAATAAGATGACGG - Intronic
961973140 3:130991378-130991400 TTGTGGTAACAGTATGATCATGG + Intronic
963099534 3:141586306-141586328 TTGCAATTATAGTGAGATGATGG + Intronic
963196559 3:142537608-142537630 TTGCAGTAACTGTCTAATGAGGG - Intronic
963849832 3:150200261-150200283 TTTCATTATCAGTAAAATGAAGG - Intergenic
963874296 3:150456643-150456665 TTGTAGTAAAATTCAGATGATGG - Intronic
963877171 3:150489364-150489386 TTCCAGGAACATGAAGATGACGG - Intergenic
964581530 3:158244610-158244632 TTTCAGTAACAGGATGATGCTGG + Intronic
964825667 3:160824905-160824927 TTGCAAAAACACTAAGCTGAAGG - Intronic
965596282 3:170414550-170414572 TTTGAATAAGAGTAAGATGAAGG + Intergenic
966088587 3:176102287-176102309 TTGTAGTAAAAGTAAAAGGAGGG + Intergenic
966351218 3:179034347-179034369 TTTGAGTTCCAGTAAGATGAAGG - Intronic
968291401 3:197542401-197542423 CTGCAGTAACAGCAAGCTGCTGG + Intronic
970026737 4:11632172-11632194 TTGGAGTAACCGTAATATGTTGG + Intergenic
970675772 4:18448660-18448682 GTGAAGTGACAGTAAGAAGATGG + Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
972194509 4:36637224-36637246 CTGCATTTACAATAAGATGACGG + Intergenic
974377511 4:61097274-61097296 TTGCAGCAAAAATCAGATGAAGG - Intergenic
974583601 4:63839145-63839167 TGGCAGAAACAGTAAGGTAATGG + Intergenic
975454177 4:74570166-74570188 TTGCTGGAACAGAAAGGTGAAGG + Intergenic
976534997 4:86202608-86202630 TTGCAGTAGTAGAAATATGAAGG + Intronic
977799557 4:101210330-101210352 TTTCAGAGACAGTAAGGTGAAGG + Intronic
977853551 4:101859953-101859975 GTGCAGAAACAGTCAAATGATGG + Intronic
979880271 4:125947507-125947529 TATGAGTAACAGTAAAATGATGG - Intergenic
980974036 4:139593782-139593804 TTGCAGGAACTGTATGTTGAAGG - Intronic
981835390 4:149047487-149047509 TTGCAGTCACTGTGAGATGCAGG - Intergenic
981970119 4:150657915-150657937 TTGCAGTAAAAGCAAAATAATGG - Intronic
984337323 4:178409211-178409233 TTACAGTAAAATTGAGATGAAGG - Intergenic
984408102 4:179359363-179359385 TTGCAGTAACATTAAGAGATAGG - Intergenic
984475424 4:180228880-180228902 TTGGAAACACAGTAAGATGAAGG - Intergenic
984523464 4:180827803-180827825 ATGCAGTAACACATAGATGAGGG + Intergenic
986839947 5:11685014-11685036 TTGCACTATGAATAAGATGAAGG - Intronic
987617054 5:20289738-20289760 TAGCAGTAACAGTACGATTAAGG + Intronic
987955028 5:24728059-24728081 TACCAATAACAGTAAGATGTTGG + Intergenic
988543354 5:32133307-32133329 TTTCAGTAACAGGAAAGTGAAGG + Intronic
989226067 5:39030403-39030425 TTGAAGTGACCGTAAGATGTTGG - Intronic
990290191 5:54342109-54342131 TTTCAGTGAAAGTATGATGATGG + Intergenic
991119663 5:62997101-62997123 GTGAAGTAACAGTGAGAAGATGG - Intergenic
991361793 5:65828380-65828402 TTGCAGGAGCAGTAACAAGATGG + Exonic
991522904 5:67520226-67520248 TTGCATTAACAGTAATTGGAGGG + Intergenic
993375042 5:87141022-87141044 TTGCACTAACAAAAAGAGGAAGG + Intergenic
993489368 5:88527609-88527631 ATGAAGTTACAGTCAGATGATGG + Intergenic
994037319 5:95216733-95216755 TTGCAGTTGCATTAAGCTGATGG + Intronic
995315063 5:110760308-110760330 TTCCAGTAACAAAGAGATGATGG - Intronic
996611980 5:125393216-125393238 TAGCAGCTACAGTAAGATGAAGG + Intergenic
997153953 5:131530581-131530603 TTTCATCAACAGTAACATGAGGG + Intronic
997893957 5:137699327-137699349 ATGGAGTAACAGTGAGAAGAAGG + Intronic
998921674 5:147075018-147075040 TTGCAGTATCAGAAAGAAAATGG + Intronic
999950279 5:156642083-156642105 GTGAAGATACAGTAAGATGATGG - Intronic
1000055585 5:157603251-157603273 TAGTAGTAACAGTAATATTATGG - Intergenic
1003717385 6:8663008-8663030 TGGCACTAAGGGTAAGATGAAGG + Intergenic
1004257413 6:14077953-14077975 TTCCAGTAACAGCTGGATGAGGG + Intergenic
1012060178 6:94468448-94468470 TAGCAGTAACAGTAAAATGTAGG - Intergenic
1012599700 6:101079880-101079902 CTGCATAAACAGTCAGATGAGGG - Intergenic
1013064091 6:106666581-106666603 TTACAGTAAAAATAAGATTAGGG + Exonic
1014246491 6:119075900-119075922 TTGTAGAAACAGAAAGATGTTGG + Intronic
1014537352 6:122630489-122630511 TTATAGAAACAGTAAAATGATGG + Intronic
1014888454 6:126812010-126812032 TTACAGTAAATGTAAGAGGAAGG + Intergenic
1015053501 6:128871142-128871164 TAACAGTATCTGTAAGATGAAGG - Intergenic
1018342809 6:162869166-162869188 TTTCATTATCAGTAAAATGAAGG + Intronic
1019131382 6:169879387-169879409 ATGCAGAAACAGTGAGATGGGGG + Intergenic
1019684761 7:2375162-2375184 TTCCAGTAAAAATAATATGATGG + Intronic
1024967453 7:55036707-55036729 TTGCAGTAACAGTAAGATGAGGG - Intronic
1026178299 7:68016867-68016889 AGGCAGTAACAGAAAGAGGAGGG + Intergenic
1026421684 7:70243978-70244000 TTACAGTAATAGTAAGAGTATGG + Intronic
1031216456 7:118899219-118899241 TTGCAGTAAAAGTAAGGAGAAGG - Intergenic
1031754739 7:125624576-125624598 TTAAAGTATCAGTAAGATGTTGG - Intergenic
1034391759 7:150792670-150792692 ATGCAGTTACAGTCAGATGGGGG - Intronic
1038348685 8:26756564-26756586 TATCAGTAACAGTAACATGTTGG + Intronic
1039326876 8:36495359-36495381 CTGCAGAAAAAGGAAGATGATGG - Intergenic
1040671216 8:49692685-49692707 TTGAAGAAATATTAAGATGATGG - Intergenic
1040977373 8:53208893-53208915 TTGCAGTAAAATTAAGAAAATGG + Intergenic
1041585759 8:59516559-59516581 TTTAAATAACAGTAAGATCATGG - Intergenic
1041786034 8:61635653-61635675 TTTCAGTAACTATTAGATGATGG - Intronic
1042296727 8:67227043-67227065 TTCAAGTAACAATAAGATTATGG - Intronic
1045812432 8:106238501-106238523 ATGCAGTGCCAGCAAGATGATGG + Intergenic
1046210456 8:111066829-111066851 TTCCAGTAACAGTAAGACACTGG + Intergenic
1046293129 8:112188379-112188401 TTCAAGAAATAGTAAGATGAGGG + Intergenic
1047154604 8:122302801-122302823 TTCCACTATCATTAAGATGAGGG + Intergenic
1048432366 8:134382155-134382177 TTGGAGTAAAAGTATGATGTGGG - Intergenic
1048636931 8:136307070-136307092 TGGCAGTAACAGTAAGCTTGTGG - Intergenic
1054843550 9:69768963-69768985 ATGCAGTTACAGAAAGATAATGG + Intergenic
1055851489 9:80636181-80636203 TTGCTGTTATAGTAAGATGTGGG + Intergenic
1056608539 9:88108473-88108495 TTGCTGAAAGACTAAGATGAAGG + Intergenic
1057634936 9:96755957-96755979 TTGCCATACCAGTAAAATGATGG + Exonic
1058656787 9:107229631-107229653 TGGCAGGAACAGTGAGATGCTGG - Intergenic
1059152591 9:111962892-111962914 TAACTGTAACAGTCAGATGATGG + Intergenic
1190337986 X:49274407-49274429 TTGGAGTAACAGAAAGACCATGG - Intronic
1190937609 X:55010512-55010534 TTTGAGGAACAGTAAGAAGATGG - Intronic
1191610886 X:63111804-63111826 TTTCAGTATCAGAAAGATGCTGG - Intergenic
1191716800 X:64199296-64199318 TTGTAGTGACTGTAAGATGAAGG - Intronic
1192116155 X:68413434-68413456 TCACAGTAACAGTAACATGTGGG - Intronic
1192608756 X:72546421-72546443 ATGGATTATCAGTAAGATGAAGG + Intronic
1197449976 X:126600651-126600673 TTGCCATAACAGGAAGTTGATGG + Intergenic
1198122019 X:133603365-133603387 GTTCACTCACAGTAAGATGAGGG - Intronic
1198959272 X:142167101-142167123 ATAAAGTAACAGTAAGCTGATGG + Intergenic
1199050455 X:143231344-143231366 CTGCAGCCAGAGTAAGATGATGG + Intergenic