ID: 1024969618

View in Genome Browser
Species Human (GRCh38)
Location 7:55056493-55056515
Sequence ATTCTAACAATATGTGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 853
Summary {0: 1, 1: 0, 2: 1, 3: 55, 4: 796}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024969618 Original CRISPR ATTCTAACAATATGTGAAAT GGG (reversed) Intronic
900588822 1:3449656-3449678 AGTCTAACAATATGTGTAACTGG - Intergenic
901897001 1:12322516-12322538 AATCTAACAAAATGTAAAAAAGG - Exonic
902140784 1:14352003-14352025 AATTTAACAATTAGTGAAATTGG + Intergenic
906308453 1:44736393-44736415 ATGCCATCAATATGTGAATTGGG + Intergenic
906605758 1:47170020-47170042 CTTCCAACACTATGTTAAATAGG - Intergenic
907448391 1:54525228-54525250 ATTTTAATAATAAGGGAAATTGG + Intergenic
908118961 1:60967826-60967848 ACTCTAACAGTATCTGGAATAGG - Intronic
908913370 1:69098550-69098572 CTTCTAACACTATGTTGAATAGG + Intergenic
909309831 1:74131844-74131866 CTTCCAACACTATGTTAAATAGG - Intronic
909380329 1:74990580-74990602 CTTCCAACAATATGTTGAATAGG - Intergenic
909422324 1:75480370-75480392 CTTCCAACACTATGTTAAATAGG - Intronic
909431806 1:75596917-75596939 CTTCTAATACTATGTTAAATAGG - Intronic
909697039 1:78479437-78479459 ATTCCAACACTATGTTGAATAGG + Intronic
909770737 1:79418253-79418275 CTTCCAACAATATGTTGAATAGG - Intergenic
909853586 1:80500769-80500791 CTTCCAACACTATGTTAAATAGG - Intergenic
910505075 1:87941221-87941243 ATTTTAACAATACATAAAATAGG - Intergenic
910905772 1:92175973-92175995 ATCCTAAAAATAGCTGAAATAGG - Intronic
911079340 1:93912746-93912768 CTTCCAACACTATGTGGAATAGG + Intergenic
911167417 1:94736340-94736362 ATTCTCACAGTCTATGAAATTGG + Intergenic
911399921 1:97361921-97361943 CTTCCAACACTATGTGTAATAGG - Intronic
911714847 1:101120116-101120138 ATTCTAATAAGATGTGTAATGGG + Intergenic
911801188 1:102140521-102140543 CTTCTAACACTATGTTGAATAGG - Intergenic
912037617 1:105340479-105340501 ATTTTTACAATATGTGTACTTGG + Intergenic
912875415 1:113353289-113353311 ATGTTAACAATAGGTGAAACTGG - Intergenic
912926153 1:113915045-113915067 ATTCTAAAAATAATTTAAATTGG - Intergenic
913258693 1:116978840-116978862 CTTCCAACAATATGTTGAATAGG - Intronic
913374897 1:118140177-118140199 CTTATAACAATACCTGAAATTGG - Intronic
913493157 1:119401350-119401372 ATTCCAACACTATGTTGAATAGG + Intergenic
914391761 1:147230033-147230055 CTTCCAACAATATGTTGAATAGG + Intronic
914403569 1:147347066-147347088 CTTCCAACAATATGTTGAATAGG - Intergenic
914405453 1:147366920-147366942 ATTCTAGCAATAAGTAATATTGG + Intergenic
914683090 1:149954070-149954092 CTTCTAACACTATGTTGAATAGG + Intronic
915851502 1:159328959-159328981 CTTCCAATAATATGTTAAATAGG - Intergenic
916603057 1:166312907-166312929 CTTCTAACATTATGTTGAATAGG + Intergenic
916613201 1:166413320-166413342 CTTCCAACACTATGTTAAATAGG + Intergenic
916621389 1:166501775-166501797 CTTCCAACACTATGTTAAATAGG - Intergenic
916836253 1:168548636-168548658 CTTCTAACACTATGTTGAATAGG - Intergenic
916862665 1:168823365-168823387 TTTCTAGGAATATATGAAATAGG - Intergenic
916976957 1:170091198-170091220 ATTCCAACACTATGTTGAATAGG + Intergenic
917022952 1:170610232-170610254 ATTCTAATACTATGTTGAATAGG + Intergenic
917308444 1:173652119-173652141 CTTCCAACACTATGTGGAATAGG + Intronic
917313316 1:173699788-173699810 CTTCCAACACTATGTGGAATAGG - Intergenic
917318449 1:173753917-173753939 AATCTTACAATCTGTCAAATTGG - Intronic
917382341 1:174426935-174426957 ATCATAACAATATGTAATATGGG + Intronic
917397680 1:174612079-174612101 CTTCTAACACTATGTTGAATAGG + Intronic
917527129 1:175798113-175798135 ATTCTTCCAATCTGTGAACTTGG - Intergenic
918662814 1:187110034-187110056 ATTGTAACAATATGTAAGAAAGG + Intergenic
918969203 1:191392296-191392318 CTTCTAATACTATGTTAAATGGG - Intergenic
919019007 1:192079314-192079336 ATTCTAACAGTAAATGAAATGGG + Intergenic
919068525 1:192724592-192724614 ATTATAACAATAATTAAAATAGG + Intergenic
919176408 1:194024579-194024601 ATTTTAAAAATATCTGAAAATGG - Intergenic
919314350 1:195952601-195952623 TATCTAACACTGTGTGAAATGGG - Intergenic
919493012 1:198228891-198228913 CTTCTAACACTATGTGGAATAGG + Intronic
920667764 1:207977766-207977788 ATCCAAAAAATATCTGAAATTGG + Intergenic
921086679 1:211800444-211800466 ATTTTAATGATATTTGAAATTGG - Intronic
921652179 1:217692515-217692537 CTTCCAACACTATGTTAAATAGG + Intronic
922551974 1:226501269-226501291 ATTCCAACACTATGTTGAATAGG + Intergenic
923927553 1:238650752-238650774 AATCTAGCAATATGTAAAATAGG + Intergenic
924014261 1:239702992-239703014 ATTTTAACAATATCTGACATGGG - Intronic
924228141 1:241939876-241939898 ATTCTAGAAAGATGGGAAATGGG + Intergenic
924617842 1:245628718-245628740 CTTCTAACACTATGTTGAATAGG - Intronic
924620174 1:245653507-245653529 ATTCTGACAACCTGTGACATAGG + Intronic
1062791977 10:312907-312929 ATTATAACAATTTCTGAACTAGG - Intronic
1063196189 10:3746067-3746089 TTTCAAACAATATGTAAGATAGG + Intergenic
1064176152 10:13076977-13076999 CTTCCAACACTATGTGTAATAGG - Intronic
1065191681 10:23217279-23217301 ATTCCCACAATTTCTGAAATGGG + Intronic
1065691961 10:28343510-28343532 CTTCTAACACTATGTTGAATAGG + Intergenic
1065736306 10:28755929-28755951 TTTCTAACATTATTAGAAATGGG - Intergenic
1065908692 10:30282470-30282492 ATCATAACCATGTGTGAAATTGG + Intergenic
1066019705 10:31286002-31286024 ATTCCAACACTATGTTGAATAGG - Intergenic
1066032252 10:31440524-31440546 TTTCCAACAATATGTTGAATAGG - Intronic
1066033461 10:31454379-31454401 ATTCCAACACTATGTTGAATAGG - Intronic
1066035085 10:31473176-31473198 ATTCCAACACTATGTTGAATAGG - Intronic
1066690907 10:38027119-38027141 TTTCTAATAAGTTGTGAAATTGG + Intronic
1066800567 10:39184012-39184034 ATTCCAACACTATGTGGAAGTGG - Intergenic
1066952524 10:42135087-42135109 CTTCTAACACTATGTTGAATAGG - Intergenic
1067001839 10:42622421-42622443 TTTCTAATAAGTTGTGAAATTGG - Intronic
1067018341 10:42773866-42773888 GGTCCAAAAATATGTGAAATTGG + Intergenic
1067230767 10:44407730-44407752 CTTCCAACACTATGTGGAATAGG + Intergenic
1067356230 10:45530382-45530404 ATAATAACAATATGAGAAACTGG + Intronic
1068132768 10:52915378-52915400 ATTTGAAGAATATGTGAATTAGG + Intergenic
1068178855 10:53496025-53496047 ATTCCAACACTATGTTTAATAGG + Intergenic
1068196971 10:53729798-53729820 ATTCCAACACTATGTTGAATAGG - Intergenic
1068197251 10:53732738-53732760 GTTCTAACAATTATTGAAATAGG - Intergenic
1068310574 10:55269249-55269271 CTTCTAATACTATGTTAAATAGG - Intronic
1068718563 10:60216288-60216310 CTTCCAACATTATGTCAAATAGG + Intronic
1071408949 10:85368048-85368070 CTTCCAATAATATGTTAAATAGG + Intergenic
1071441861 10:85706079-85706101 CTTCCAACACTATGTTAAATAGG - Intronic
1071952466 10:90720343-90720365 AATCTCATAATATGTGAGATTGG - Intergenic
1072091603 10:92134134-92134156 CTTCTAACACTATGTTGAATAGG - Intronic
1072111142 10:92321387-92321409 ATTCTAATAATATGGCATATTGG + Intronic
1072406796 10:95162335-95162357 CTTCTAACACTATGTTGAATAGG + Intergenic
1072836739 10:98722988-98723010 CTTCTAACACTATGTTGAATAGG + Intronic
1072974425 10:100045196-100045218 ATTTAAAGAATATGTGAAAAGGG + Intronic
1073367140 10:102952396-102952418 CTACTAACAATATGAAAAATTGG + Intronic
1073415646 10:103379535-103379557 ATCCTATCAAGATGTAAAATGGG + Intronic
1073669619 10:105573295-105573317 GTTCTAAAAAAATATGAAATTGG + Intergenic
1073680887 10:105702158-105702180 ATTCATACAATATGTGAACAAGG + Intergenic
1073829996 10:107372916-107372938 GTTCTATTAATATGTGAAATGGG - Intergenic
1073979242 10:109135523-109135545 CTTCCAACACTATGTGGAATAGG - Intergenic
1074023430 10:109608923-109608945 CTTCTAACACTATGTTGAATAGG - Intergenic
1074236310 10:111587900-111587922 CTTCCAACAATATGTTGAATAGG - Intergenic
1075056367 10:119221738-119221760 ATCATAATAATTTGTGAAATAGG + Intronic
1076112981 10:127874774-127874796 ATTCTAATCATCTGTGAAATGGG - Intergenic
1076179152 10:128392568-128392590 AATCCTAAAATATGTGAAATGGG - Intergenic
1077783631 11:5359111-5359133 ATTCCAACACTATGTTGAATAGG - Intronic
1077818824 11:5715459-5715481 CTTCCAACAATATGTTGAATAGG - Intronic
1078111794 11:8400587-8400609 CTTCCAACACTATGTTAAATAGG - Intronic
1078122025 11:8520461-8520483 CTTCCAACACTATGTTAAATAGG - Intronic
1078802929 11:14665385-14665407 CTTCCAACAGTATGTGGAATAGG - Intronic
1080354226 11:31423021-31423043 AATCTAACAATTTCTGAAAAAGG - Intronic
1080484760 11:32694032-32694054 CTTCTAACACTATGTTGAATAGG - Intronic
1080498023 11:32840415-32840437 ATATTAACAATGTGGGAAATTGG - Intronic
1081089503 11:38845866-38845888 ATGTTAACAATATGGGAAATTGG + Intergenic
1081113252 11:39163246-39163268 ATTTTATCAATAGGTGAAATAGG + Intergenic
1081166442 11:39814042-39814064 CTTCTAATACTATGTGGAATAGG - Intergenic
1082109553 11:48259344-48259366 CTTCTAACACTATGTTGAATAGG - Intergenic
1082137267 11:48563600-48563622 TTTCCAACACTATGTTAAATAGG + Intergenic
1082144099 11:48646221-48646243 CTTCCAACATTATGTGGAATAGG + Intergenic
1082966862 11:58975001-58975023 CTTCTAACACTATGTTGAATAGG - Intronic
1082967826 11:58985956-58985978 CTTCCAACACTATGTTAAATAGG + Intronic
1083011561 11:59405987-59406009 ATTCCAACACTATGTTGAATAGG - Intergenic
1083124852 11:60554477-60554499 CTTCTAACACTATGTTGAATAGG - Intergenic
1085053390 11:73391015-73391037 ATTCTTCCCATCTGTGAAATGGG + Intronic
1085441512 11:76568033-76568055 ATTTTAACAATAGGAGAAACTGG - Intergenic
1085652052 11:78277299-78277321 ACTCTAACAATGTGAGAAATGGG - Intronic
1085985158 11:81777785-81777807 TTTCTAATAATCTGTGATATAGG - Intergenic
1086442468 11:86842400-86842422 ATTCCAACACTATGTTGAATTGG - Intronic
1086877504 11:92113804-92113826 ATTCTGACAATATGACAAAATGG + Intergenic
1087328467 11:96751920-96751942 ATTCTAATACTATGTTGAATAGG + Intergenic
1087520132 11:99222481-99222503 ATTTTAATCATATGTAAAATTGG - Intronic
1087615025 11:100477743-100477765 CTTCCAACACTATGTTAAATAGG + Intergenic
1087678634 11:101192213-101192235 ATTGAAACAATAAGTTAAATTGG - Intergenic
1087801871 11:102513108-102513130 AATGTAACAATATGGGAAGTTGG - Intergenic
1087955469 11:104281161-104281183 ATTAGAACAATATTTTAAATTGG + Intergenic
1088302383 11:108373168-108373190 ATTCTATCAATATAAGAAAGAGG + Intronic
1088421390 11:109651725-109651747 ATTCTTACCATAGGGGAAATAGG - Intergenic
1090010785 11:123044262-123044284 ATCCTAAGAATAAGTCAAATCGG + Intergenic
1090166557 11:124555046-124555068 CTTCTAACACTATGTTGAATAGG - Intergenic
1090919302 11:131194007-131194029 ATTCTTAGAGTAAGTGAAATGGG + Intergenic
1091073360 11:132590262-132590284 ATTCAAAAAATATTTGAAGTAGG - Intronic
1092371246 12:7918112-7918134 CATATAACAAGATGTGAAATTGG + Intergenic
1092495010 12:8984972-8984994 ATGCTAACATTAGGGGAAATGGG - Intronic
1092561126 12:9614421-9614443 CTTCCAACACTATGTTAAATAGG - Intergenic
1093376357 12:18432660-18432682 CTTCTAATAATATTTGAATTTGG + Intronic
1093597336 12:20977769-20977791 CTTCCAACACTATGTTAAATAGG + Intergenic
1093676278 12:21943603-21943625 TTTTTAACAATATGACAAATTGG - Intergenic
1094792855 12:33934531-33934553 CTTCCAACACTATGTTAAATAGG - Intergenic
1095248487 12:39950384-39950406 AATCTAACAATATGTGCCCTGGG + Intronic
1095588263 12:43872344-43872366 ATTCTAAAAATAAATGAAAAAGG + Intronic
1095854380 12:46844138-46844160 ATTTTAACTCTATGTGGAATAGG + Intergenic
1096926472 12:55153466-55153488 CTTCCAACAATATGTTGAATAGG + Intergenic
1097210639 12:57366082-57366104 AGTCTAAAAATATGTGTAATTGG - Intronic
1097555701 12:61134816-61134838 CTTCTAACACTATGTTGAATAGG + Intergenic
1097600924 12:61692587-61692609 ATTCTTTCAATCTTTGAAATGGG - Intergenic
1098043765 12:66379181-66379203 ATACTAACAATATGTGCTACTGG + Intronic
1098246257 12:68521383-68521405 TTTCTAGAAATATATGAAATAGG + Intergenic
1098428389 12:70391909-70391931 ATTGTAAGAGTATGTGAAATGGG + Intronic
1098727108 12:73981852-73981874 CTTCCAACAATATGTTGAATAGG - Intergenic
1099677404 12:85779327-85779349 ATTCTTAGAACATGTGAAAAAGG + Intergenic
1099786457 12:87270156-87270178 ATTTTAACAATACTTGCAATGGG + Intergenic
1101068784 12:101050996-101051018 ATTCAAAGTATATTTGAAATTGG - Intronic
1101126126 12:101635145-101635167 ATTGCAAAAATATATGAAATAGG - Intronic
1104100372 12:125602581-125602603 CTTCCAACACTATGTTAAATAGG - Intronic
1105054189 12:133081735-133081757 ATTCTAACACTGTGGGAAAGAGG - Intronic
1105232234 13:18507580-18507602 CTTCCAACACTATGTGGAATAGG - Intergenic
1106083533 13:26520345-26520367 ATATTAACAATAGGTGAAACTGG - Intergenic
1106415058 13:29539540-29539562 TTTCTAACATAATGTGAAAAGGG + Intronic
1107090136 13:36470323-36470345 ATTCCAACACTATGTTGAATAGG + Intergenic
1107492150 13:40891059-40891081 CTTCCAACACTATGTGGAATAGG - Intergenic
1107506978 13:41044320-41044342 CTTCCAACACTATGTGGAATAGG + Intronic
1107768807 13:43767555-43767577 TTTCTAACAATCAGTGCAATTGG + Intronic
1108270756 13:48757093-48757115 AATCTAAGAAAATGTGATATTGG - Intergenic
1109095054 13:58103572-58103594 TTTCCAACAATATGTTGAATAGG + Intergenic
1109477933 13:62909180-62909202 AATCTAACATTAGGTGAAATAGG + Intergenic
1109612955 13:64790761-64790783 ACTCTTACAATCTGTGAACTTGG - Intergenic
1109675570 13:65671832-65671854 CTTCCAACACTATGTTAAATAGG + Intergenic
1110087879 13:71405061-71405083 ATTCTCACAATATATCAAACTGG - Intergenic
1110728861 13:78856933-78856955 CTTCCAACACTATGTGGAATAGG + Intergenic
1110993868 13:82079333-82079355 ATTCTAACAGTCTGTAGAATTGG - Intergenic
1111499045 13:89091867-89091889 ATTCCAACAATATGTTTAATAGG - Intergenic
1111521845 13:89414886-89414908 AACCTAACAGTATGTAAAATGGG - Intergenic
1111532665 13:89559608-89559630 CTTCTAATACTATGTTAAATAGG - Intergenic
1113059567 13:106307564-106307586 ATTCCAACACTATGTTGAATAGG - Intergenic
1113217262 13:108056776-108056798 ATTCTAATCATCTGTGACATAGG + Intergenic
1113300603 13:109014985-109015007 CTTCCAACAATATGTTGAATAGG + Intronic
1113488480 13:110673681-110673703 CTTCCAACACTATGTTAAATAGG - Intronic
1113755168 13:112806030-112806052 ATTTTAACAGTCAGTGAAATAGG + Intronic
1114246024 14:20914693-20914715 CTTCCAACAATATGTTGAATAGG - Intergenic
1114580908 14:23758732-23758754 CTTCCAACACTATGTCAAATAGG + Intergenic
1114596843 14:23919766-23919788 CTTCTAACACTATGTTGAATAGG - Intergenic
1114765554 14:25366794-25366816 CTTCCAACAATATGTTGAATAGG + Intergenic
1114872500 14:26675341-26675363 ATTCCAACACTATGTTGAATAGG + Intergenic
1114914186 14:27241221-27241243 ATTCCATCAATATATGAATTTGG + Intergenic
1115141405 14:30175502-30175524 CTTCCAACAATATGTTGAATAGG + Intronic
1115327808 14:32161879-32161901 ATTCTAACTATATGGGAATTTGG - Intergenic
1115644793 14:35361350-35361372 ATTTTAAAAATAGGTGAAACGGG + Intergenic
1115750406 14:36483762-36483784 TTTCTAAAAGTATATGAAATTGG + Intronic
1115832678 14:37359843-37359865 CTTCCAACACTATGTTAAATAGG + Intronic
1116100195 14:40423950-40423972 CTTCTAACACTATGTTAAATAGG + Intergenic
1116218315 14:42048916-42048938 ATTTAAACAATATGGGAAAATGG - Intergenic
1116304335 14:43231176-43231198 CTTCTAATAATATGTTGAATAGG - Intergenic
1116637599 14:47417214-47417236 CTTCTAGCAAAATGTGAAAAAGG - Intronic
1117168722 14:53067840-53067862 ATGCTAACAATATGTGAACCTGG - Intronic
1117205526 14:53439093-53439115 ATTCAGATAATATGAGAAATAGG + Intergenic
1117260639 14:54029715-54029737 ATTCCAACACTATGTTGAATAGG + Intergenic
1117436699 14:55721833-55721855 ATTCTAAAAATGTTTGAAATGGG - Intergenic
1117525836 14:56602944-56602966 TTTCTAACACTATTAGAAATAGG + Intronic
1117603562 14:57400643-57400665 ATTCTCAAAATATGTGAAATTGG + Intronic
1117884052 14:60341125-60341147 ATTCCAACACTATGTTGAATAGG - Intergenic
1117999362 14:61508724-61508746 ATCCTTACCATATGTGATATTGG - Intronic
1118075000 14:62288491-62288513 ATTCCAACACTATGTTGAATAGG - Intergenic
1118094806 14:62524479-62524501 CTTCTAACACTATGTTGAATAGG - Intergenic
1118146297 14:63141008-63141030 CTTCTAACACTATGTTGAATAGG + Intergenic
1118414850 14:65524597-65524619 CTTCCAACACTATGTTAAATAGG + Intronic
1118787477 14:69058134-69058156 ATTCCAACCATTTGTGAAATTGG + Intronic
1119000128 14:70873983-70874005 ATGTTTACTATATGTGAAATGGG - Intergenic
1119153240 14:72385288-72385310 ATGCTAAAAATATGTTAAAAGGG + Intronic
1120332045 14:83105620-83105642 ATTCTAACATTTTATGAACTTGG + Intergenic
1120338286 14:83187460-83187482 CTTCCAACACTATGTTAAATAGG + Intergenic
1121745419 14:96286160-96286182 ATTCTAACTATAAGGGAAAGAGG + Intronic
1202877004 14_KI270722v1_random:12581-12603 ATTCCAACACTATGTTGAATAGG - Intergenic
1123663690 15:22589164-22589186 CTTCTGACAAAATGTGAAATGGG - Intergenic
1124119936 15:26880448-26880470 ACTCTAGCAATATGAGAACTCGG + Intronic
1124565926 15:30813895-30813917 CTTCTGACAAAATGTGAAATGGG + Intergenic
1124886029 15:33687034-33687056 CTTCTAACACTATGTTGAATAGG - Intronic
1125143598 15:36439613-36439635 ATTATATTAATATGTGAACTTGG + Intergenic
1125220213 15:37324056-37324078 CTTCCAACAATATGTTGAATAGG - Intergenic
1125894505 15:43291087-43291109 CTTCCAACACTATGTTAAATAGG + Intronic
1126211806 15:46108624-46108646 CTTCTAACACTATGTTGAATAGG - Intergenic
1126235417 15:46378031-46378053 CTTCCAACACTATGTTAAATAGG + Intergenic
1126279602 15:46929347-46929369 ATTTTAGTAATATGTTAAATAGG + Intergenic
1126561121 15:50045328-50045350 ATTTTAACAGTATGTGATCTTGG - Intronic
1126962743 15:54016073-54016095 AATCAAAGAATATGTTAAATGGG + Intronic
1127138343 15:55947919-55947941 CTTCTAACACTATGTTGAATAGG - Intronic
1127451322 15:59119191-59119213 AATGTAACTACATGTGAAATTGG + Intronic
1127540343 15:59931682-59931704 ATTTTAACAAAATGTGAATGTGG - Intergenic
1127748243 15:62003543-62003565 CTTCCAACACTATGTGGAATAGG + Intronic
1127749389 15:62018310-62018332 CTTCCAACACTATGTGGAATAGG + Intronic
1128567287 15:68709847-68709869 ATTCTACCAGTAGGTGAAACAGG + Intronic
1128955760 15:71941544-71941566 ATTCTAACAACATTTGTAACTGG + Intronic
1130641633 15:85681442-85681464 ATTCTAAGACTATGTCAGATAGG - Intronic
1131670787 15:94617556-94617578 ATTTTAACAATAAAAGAAATTGG - Intergenic
1131717294 15:95126866-95126888 ATTCTAACAATAAGTGTCTTTGG - Intergenic
1131808008 15:96143066-96143088 ATTTTTACCATCTGTGAAATGGG - Intergenic
1132192754 15:99882665-99882687 CTTCTAACACTATGTTGAATAGG + Intergenic
1134785311 16:16937128-16937150 ATTCTAACTATATGACATATTGG + Intergenic
1135789738 16:25382838-25382860 AATCACACAATATTTGAAATTGG - Intergenic
1135799833 16:25482726-25482748 ATTATAAGAATATTTGAAAAAGG - Intergenic
1137681239 16:50347377-50347399 CTTCCAACACTATGTTAAATAGG - Intronic
1137959436 16:52866947-52866969 ATTATCCCCATATGTGAAATGGG - Intergenic
1138284331 16:55797153-55797175 ATTCTTACACTCTGTGTAATTGG + Intergenic
1138284671 16:55799834-55799856 ATTCTTACACTCTGTGTAATTGG - Intergenic
1138932841 16:61682330-61682352 AATCTAAGAAGATGTGAAACTGG + Intronic
1139071842 16:63392058-63392080 CTTCCAACACTATGTTAAATAGG - Intergenic
1139868492 16:70083697-70083719 ATTCTAAAAATATCTGCCATAGG - Intergenic
1140386844 16:74548176-74548198 ATTCTAAAAATATCTGCCATAGG + Intronic
1140569683 16:76088763-76088785 CTTCTAACACTATGTTGAATAGG + Intergenic
1140648592 16:77062798-77062820 TTTGTAATAGTATGTGAAATCGG - Intergenic
1140949249 16:79800387-79800409 ATTCTAACCAGATGTGAATCTGG + Intergenic
1141795005 16:86266151-86266173 ATTCCAACACTATGTTGAATAGG - Intergenic
1142091965 16:88218735-88218757 CTTCCAACACTATGTGGAATAGG - Intergenic
1143607804 17:8000183-8000205 ATGCTAACAATAGGTGAATCTGG - Intergenic
1143929694 17:10409225-10409247 ATTATAACATTATGTGAGAATGG + Intronic
1144112811 17:12053592-12053614 ATTCAAACAACATGTGCAAAGGG - Intronic
1144150466 17:12438377-12438399 ATTCCAACGCTTTGTGAAATTGG - Intergenic
1145396409 17:22498977-22498999 ATTCCAACACTATGTTGAATAGG + Intergenic
1146031925 17:29373624-29373646 TTTTTAAAAATATGTGAAATGGG + Intergenic
1146076348 17:29733360-29733382 ATTCTTTCAATATGTTTAATTGG - Intronic
1148137227 17:45301589-45301611 ATTTTAACAATATGGAAAAATGG + Intronic
1148708528 17:49658500-49658522 TTCCTAACAATATGTCAAAGTGG + Intronic
1148952955 17:51330572-51330594 ATTCCAACACTATGTTGAATAGG - Intergenic
1149059511 17:52405864-52405886 CTTCTAACACTATGTTGAATAGG + Intergenic
1149721399 17:58848297-58848319 CTTCTAACACTATGTTGAATAGG + Intronic
1151733655 17:75925513-75925535 ATTCTAACAAAAGCTGAATTTGG + Intronic
1203162733 17_GL000205v2_random:65736-65758 CTTCCAACACTATGTGGAATAGG + Intergenic
1153164965 18:2251149-2251171 CTTCTAACACTATGTTGAATAGG - Intergenic
1153355486 18:4130237-4130259 ATTCTGAAAATTTGGGAAATAGG - Intronic
1153424759 18:4950151-4950173 CTTCTAATAATATGTTGAATAGG - Intergenic
1153486030 18:5599180-5599202 CTCCTAACATTATGTGAATTAGG - Intronic
1153558595 18:6345699-6345721 ATTTTTACAATCTGTGAAAAGGG - Intronic
1154401228 18:14039612-14039634 CTTCTAACACTATGTTGAATAGG + Intergenic
1154520301 18:15220619-15220641 CTTCCAACACTATGTGGAATAGG - Intergenic
1154521090 18:15231127-15231149 CTTCCAACACTATGTGGAATAGG + Intergenic
1154533170 18:15368990-15369012 CTTCCAACACTATGTGGAATAGG + Intergenic
1154533540 18:15373010-15373032 CTTCCAACACTATGTGGAATAGG - Intergenic
1155198119 18:23493930-23493952 ATACCAACAATATATGAATTTGG + Intergenic
1155430138 18:25746644-25746666 ATTCCAATATTATGTTAAATAGG - Intergenic
1155661660 18:28256360-28256382 TTTCTAAAAATATGTGCAATGGG + Intergenic
1156076601 18:33286449-33286471 ATACTAACAATTTATCAAATAGG - Intronic
1156145975 18:34178764-34178786 ATTCTATCCATTTTTGAAATTGG - Intronic
1156147637 18:34204936-34204958 TTTCTCAATATATGTGAAATGGG - Intronic
1156730349 18:40186724-40186746 ATTGAAACAGTTTGTGAAATTGG - Intergenic
1157050878 18:44162814-44162836 CTTCTAACACTATGTTGAATAGG + Intergenic
1157410758 18:47461079-47461101 ATTCTAATAATTTGAAAAATTGG - Intergenic
1158364335 18:56714762-56714784 ATTATTACACTATGTGAAAGGGG + Intronic
1158484373 18:57851944-57851966 ATTCTAACAATTTGTGAACATGG - Intergenic
1158657183 18:59348470-59348492 CTTCTAAAAATATGGAAAATAGG + Intronic
1158795662 18:60843143-60843165 CTTCCAACACTATGTGGAATAGG - Intergenic
1159126285 18:64228407-64228429 CTTCCAACACTATGTGGAATAGG + Intergenic
1159387008 18:67740127-67740149 ATTCTGACACTATGTAGAATGGG + Intergenic
1159452458 18:68619699-68619721 CTTCCAATAATATGTCAAATAGG - Intergenic
1159828160 18:73240615-73240637 ATGGTAATAATATGTGAATTTGG + Intronic
1159859450 18:73630163-73630185 CTTCTAACACTATGTTGAATAGG - Intergenic
1159986344 18:74846310-74846332 TTTCTAACAATGTCTGAACTGGG + Intronic
1160136464 18:76275749-76275771 AATCTTTCAATATGGGAAATGGG + Intergenic
1163972448 19:20811788-20811810 CTTCCAACAATATGTTGAATAGG - Intronic
1164360550 19:27503514-27503536 CTTCCAACACTATGTTAAATAGG - Intergenic
1164395164 19:27856776-27856798 CTTCCAACACTATGTTAAATAGG - Intergenic
1165607707 19:37120591-37120613 ATTCCAACACTATGTTGAATAGG - Intronic
1167536466 19:50056064-50056086 ATTATAACATTATTTGTAATTGG + Intergenic
1167802971 19:51757590-51757612 CTTCTAACACTATGTTGAATAGG - Intronic
1168376006 19:55879816-55879838 ATTATAATAATAAGTGATATAGG - Intronic
1202673671 1_KI270710v1_random:20351-20373 ATTCCAACACTATGTTGAATAGG + Intergenic
926427931 2:12756613-12756635 ACTCTCTCAATATGTGAATTTGG + Intergenic
926896155 2:17691682-17691704 CTTCCAACACTATGTGGAATAGG - Intronic
927221592 2:20715498-20715520 CTTCCAACACTATGTTAAATAGG - Intronic
927248760 2:20979830-20979852 CTTCCAACACTATGTTAAATAGG + Intergenic
927272429 2:21226633-21226655 TTTTTAACAATCTGGGAAATAGG + Intergenic
927301692 2:21523016-21523038 CTTCCAACACTATGTTAAATAGG + Intergenic
928246960 2:29638706-29638728 GTTCTAACACCATCTGAAATGGG + Intronic
928315777 2:30244354-30244376 ATTTTAACAAAATGTTAAAATGG + Intronic
928487933 2:31751426-31751448 CTTCTAACACTATGTTGAATAGG - Intergenic
928739718 2:34336735-34336757 GTTCTAACAATATGTACAAATGG + Intergenic
928758605 2:34555665-34555687 ATTCCAACACTATGTTGAATAGG + Intergenic
928817893 2:35321778-35321800 CTTCTAACACTATGTTGAATAGG + Intergenic
928942988 2:36745828-36745850 CTTCTAGTACTATGTGAAATAGG + Intronic
929294776 2:40234623-40234645 CTTCCAACAATATGTTGAATAGG + Intronic
930618169 2:53615659-53615681 TTTCTAAAAATATATGCAATGGG + Intronic
931029915 2:58162069-58162091 ATTATAACAATGTATGATATGGG - Intronic
931243639 2:60475264-60475286 ATTTTCAGAAAATGTGAAATTGG - Intronic
931481371 2:62644393-62644415 ATTCCAACACTATGTTGAATAGG + Intergenic
931888541 2:66644641-66644663 CTTCCAACACTATGTGGAATAGG + Intergenic
932024239 2:68117500-68117522 ATTCTCAAAGCATGTGAAATAGG + Intergenic
932759822 2:74431832-74431854 ATTCTAAGAATATGCCAATTTGG - Intronic
932993227 2:76813828-76813850 ATGGTAAGAATACGTGAAATTGG - Intronic
933020051 2:77178644-77178666 ATTAAAAGAATATATGAAATAGG - Intronic
933430186 2:82166984-82167006 ATTCTGATAAAATGTAAAATGGG - Intergenic
934966339 2:98727105-98727127 TTTATGACAATATGTGAAAGAGG - Intronic
935441496 2:103103127-103103149 ATTCTAATAGAATGTGCAATGGG - Intergenic
935729625 2:106054798-106054820 ATTTTAAAAATACGTGAAACTGG - Intergenic
936712894 2:115153316-115153338 ATTCCAACAGTAAGTAAAATGGG - Intronic
936891509 2:117375868-117375890 AATCTTAAAATTTGTGAAATGGG - Intergenic
937002512 2:118480604-118480626 ATTCTAAAAATATCTGAGTTGGG + Intergenic
937467090 2:122142960-122142982 CTTCTAACACTATGTTGAATAGG + Intergenic
938520441 2:132064891-132064913 CTTCCAACAGTATGTGGAATAGG + Intergenic
938591775 2:132746081-132746103 ATTCTAAAATTATGTGAAAATGG + Intronic
938857589 2:135330078-135330100 CTTCCAACAATATGTTGAATAGG + Intronic
939084355 2:137700092-137700114 CTTCTAATACTATGTTAAATAGG - Intergenic
940468341 2:154061135-154061157 ATGCTAACAATAGGTGAATCTGG - Intronic
940580381 2:155572245-155572267 CTTCCAACAATATGTTGAATGGG + Intergenic
940763283 2:157762098-157762120 ATTATAAAAATAGGTGAAAGAGG - Intronic
941032363 2:160527038-160527060 CTTCCAACACTATGTTAAATAGG + Intergenic
941235484 2:162966998-162967020 ATTTTAAAGTTATGTGAAATAGG + Intergenic
941453503 2:165688500-165688522 ATTTTAAAAATATGTATAATTGG + Exonic
941509512 2:166388178-166388200 ATTTTAAAAATATGTAATATAGG - Intergenic
941726435 2:168865587-168865609 CTTCTAACACTATGTTGAATAGG - Intronic
942130687 2:172876272-172876294 CTTCTAACACTATGTTGAATAGG + Intronic
942214102 2:173701404-173701426 ATTCCAACACTATGTTGAATAGG + Intergenic
942710710 2:178832193-178832215 ATTCACACATTATTTGAAATTGG + Exonic
942771410 2:179525326-179525348 ATCCTAAGAATATGAGAAATAGG - Intronic
942780273 2:179633670-179633692 CTTCTAACACTATGTTGAATAGG - Intronic
942895776 2:181052544-181052566 ATTTTAAAAATATCTGAAAATGG + Intronic
943246121 2:185452561-185452583 ATTGTATAAATATGTGATATAGG - Intergenic
943722005 2:191214530-191214552 ATTGTACAAATATGTGAAAGTGG - Intergenic
943889568 2:193269810-193269832 ATTCTATCAAAATGTGATATTGG + Intergenic
943946347 2:194070479-194070501 CTTCTAACACTATGTTGAATAGG + Intergenic
944235752 2:197440043-197440065 ATTTAAACAATATTTGAATTAGG + Intergenic
944523177 2:200591857-200591879 ATTCAGACAATAGGTGATATGGG + Intronic
944813790 2:203354686-203354708 CTTATCACAATATGTGAACTGGG - Intronic
945409562 2:209492407-209492429 CTTCTAATACTATGTTAAATAGG - Intronic
945507029 2:210654288-210654310 ATTCTAACAGTATGAAACATAGG - Intronic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
945798961 2:214400707-214400729 AATCTACCATTATGTGAACTTGG - Intronic
945818480 2:214634386-214634408 ATTCCAACACTATGTTGAATAGG + Intergenic
946598364 2:221331901-221331923 TTTATAACAACATGTGACATCGG + Intergenic
946638933 2:221762492-221762514 ATTCCCACAATCTGTGAAATGGG + Intergenic
947253213 2:228132695-228132717 ATTTTAAAAATATTTAAAATTGG + Intronic
1169986656 20:11452530-11452552 ATTCTCAGAATATGTGAACATGG - Intergenic
1170001482 20:11619255-11619277 CTTCTAAAAATATGCGAACTTGG + Intergenic
1170082846 20:12495708-12495730 ATTCCAACACTATGTTGAATAGG - Intergenic
1170180007 20:13519739-13519761 CTTCCAACACTATGTTAAATAGG - Intronic
1170370511 20:15642980-15643002 ATTCCAACAAGATGTTCAATTGG - Intronic
1170925156 20:20715966-20715988 AAACTAACAATATATGTAATTGG + Intergenic
1171058394 20:21931061-21931083 CTTCCAACACTATGTTAAATAGG - Intergenic
1171281080 20:23898875-23898897 CTTCCAACAATATGTTGAATAGG + Intergenic
1171733522 20:28740447-28740469 ATTCCAACACTATGTTGAATAGG - Intergenic
1171775966 20:29368080-29368102 ATTCCAACACTATGTTGAATAGG + Intergenic
1173063900 20:39690875-39690897 AGTTTATCCATATGTGAAATGGG + Intergenic
1174028433 20:47599666-47599688 AATCTAACAATGTTTGAGATAGG - Intronic
1174971090 20:55276384-55276406 CTTCCAACACTATGTTAAATAGG + Intergenic
1174975962 20:55334360-55334382 ATTTTAAAAATGTGTGAAAAAGG - Intergenic
1175435903 20:58947770-58947792 ATTCTCAAAGAATGTGAAATAGG - Intergenic
1175511826 20:59533801-59533823 ATTCCAACACTATGTTGAATAGG + Intergenic
1176328839 21:5528502-5528524 AATATAACAATATGCAAAATAGG - Intergenic
1176398918 21:6292449-6292471 AATATAACAATATGCAAAATAGG + Intergenic
1176438239 21:6696655-6696677 AATATAACAATATGCAAAATAGG - Intergenic
1176462501 21:7023725-7023747 AATATAACAATATGCAAAATAGG - Intergenic
1176486062 21:7405503-7405525 AATATAACAATATGCAAAATAGG - Intergenic
1176642052 21:9314734-9314756 CTTCCAACACTATGTGGAATAGG - Intergenic
1176776209 21:13135881-13135903 CTTCCAACACTATGTGGAATAGG - Intergenic
1177618997 21:23562335-23562357 ATTCTAATACTATGTTGAATAGG + Intergenic
1177876757 21:26642993-26643015 CTTCTAACACTATGTTGAATAGG + Intergenic
1178219592 21:30641083-30641105 CTTCCAACACTATGTTAAATAGG - Intergenic
1178611398 21:34084886-34084908 ATTCTAACAATTAGTGATCTAGG - Intronic
1178903935 21:36620634-36620656 CTTCCAACACTATGTGGAATAGG - Intergenic
1179378125 21:40870371-40870393 ATGATATCAATATGTGAAATAGG + Intergenic
1180351064 22:11804088-11804110 CTTCCAACACTATGTGGAATAGG - Intergenic
1180387137 22:12187987-12188009 CTTCCAACACTATGTGGAATAGG + Intergenic
1180415055 22:12701700-12701722 ATTCCAACACTATGTTGAATAGG - Intergenic
1180524201 22:16239154-16239176 CTTCCAACACTATGTGGAATAGG - Intergenic
1181886515 22:26026382-26026404 ATTCATACAATTTGTGCAATCGG - Intronic
1181891947 22:26070934-26070956 ATCCTAACAAAATGTAAAATGGG - Intergenic
1182870688 22:33644529-33644551 CTTCCAACACTATGTTAAATAGG - Intronic
1183247596 22:36705788-36705810 AGTCTTACCATATGTTAAATGGG + Intergenic
1184223872 22:43117971-43117993 ATTTTAAAAATATATGAAATGGG - Intronic
1184494237 22:44828252-44828274 ATTCTCACAATGTCTGAAAAAGG - Intronic
949207814 3:1461085-1461107 CTTCTAACACTATGTTGAATAGG + Intergenic
949873634 3:8609742-8609764 ATAATGACAATATGTGACATTGG + Intergenic
950037348 3:9896501-9896523 TTTAGAACAATCTGTGAAATAGG - Intergenic
951175321 3:19592285-19592307 ATTCCAACACTATGTTGAATAGG + Intergenic
951861647 3:27260243-27260265 ATTCCAACACTATGTTGAATAGG + Intronic
952595828 3:35016358-35016380 ATTCCAACACTATGTTGAATAGG + Intergenic
953705577 3:45227400-45227422 TTTCTAACAATGAGTAAAATGGG + Intergenic
954490220 3:50897505-50897527 CTTCCAACACTATGTTAAATAGG + Intronic
955181045 3:56670123-56670145 GTTCAAACCATATGTGAAAAAGG - Exonic
955441287 3:58957695-58957717 TTTCCAACAATATATGGAATTGG + Intronic
956512411 3:70008662-70008684 CTTCTAACACTATGTTGAATAGG + Intergenic
956513258 3:70017607-70017629 CTTCTAACACTATGTTGAATAGG + Intergenic
957017815 3:75090376-75090398 ATTCCATGAATATGTAAAATTGG - Intergenic
957618458 3:82564601-82564623 ATACTAATTATATGTAAAATAGG - Intergenic
957761730 3:84567570-84567592 TTTCTAACAAAATGGGAAAATGG - Intergenic
958204414 3:90371395-90371417 TTTCTAACACTATGTTGAATAGG + Intergenic
958218503 3:90626295-90626317 CTTCTAACACTATGTTGAATAGG - Intergenic
958403917 3:93728106-93728128 CTTCTAACACTATGTTGAATAGG + Intergenic
958409891 3:93803410-93803432 ATTCCAACACTATGTTGAATAGG + Intergenic
959052457 3:101537233-101537255 CTTCTAACAATATGTTGAATAGG + Intergenic
959193371 3:103144279-103144301 AGTGTAACAATATTAGAAATGGG - Intergenic
959736838 3:109668909-109668931 CTTCCAACACTATGTGGAATAGG - Intergenic
959778841 3:110203662-110203684 CTTCCAACACTATGTGGAATAGG + Intergenic
959885156 3:111490692-111490714 CTTCTAACACTATGTTGAATGGG - Intronic
959910112 3:111754674-111754696 CTTCTAACACTATGTTGAATAGG + Intronic
959952042 3:112190257-112190279 CTTCTAACACTATGTTGAATAGG + Intronic
960559025 3:119062052-119062074 ATTCTAATAACCTGTGAAGTAGG - Intronic
960784063 3:121352705-121352727 CTTCCAACATTATGTTAAATAGG + Intronic
961243443 3:125431931-125431953 CTCCTAACAATCTGTGAAGTAGG - Intergenic
962460532 3:135608111-135608133 CTTCCAACACTATGTTAAATAGG - Intergenic
962645475 3:137434624-137434646 CTTCTAACACTATGTTGAATAGG - Intergenic
962849839 3:139300115-139300137 AATCTTATAATATGTAAAATGGG - Intronic
963032402 3:140991633-140991655 CTTCCAACAATATGTTGAATAGG - Intergenic
963048187 3:141119514-141119536 CTTCCAACAATATGTTGAATAGG + Intronic
963359004 3:144246409-144246431 ATACTAAAAATATCTGTAATGGG - Intergenic
963387578 3:144616632-144616654 ATTCCAACACTATGTTGAATAGG + Intergenic
964000520 3:151766275-151766297 ATGTTAACAATAGGGGAAATGGG - Intergenic
964189480 3:153985424-153985446 ATTCCAACACTATGTTGAATAGG + Intergenic
964500588 3:157344145-157344167 CTTCCAACACTATGTTAAATAGG - Intronic
964551422 3:157889127-157889149 TTTGTAACAATATGTGAAACAGG - Intergenic
964577991 3:158196524-158196546 CTTCTAACACTATGTTGAATAGG + Intronic
964659515 3:159104884-159104906 ATTATAACAATGTGTGACCTTGG - Intronic
964715623 3:159718349-159718371 ATTCCAACACTATGTTGAATAGG - Intronic
964770487 3:160219723-160219745 CTTCTAACATTAAATGAAATGGG - Intergenic
965001631 3:162961803-162961825 CTTCTAACACTATGTTGAATAGG - Intergenic
965027357 3:163319138-163319160 CTTCTAACACTATGTTGAATAGG + Intergenic
965061176 3:163787467-163787489 ATTTTAATAATATGTGCCATAGG - Intergenic
965982921 3:174714821-174714843 ATTCCAACACTATGTTGAATAGG + Intronic
965991706 3:174826847-174826869 ATTCTAACAATAGGTAGAAGTGG - Intronic
966046769 3:175560932-175560954 TTTCTAACATTATTTGAAGTGGG + Intronic
966488531 3:180499779-180499801 CTTCCAACAGTATGTTAAATAGG + Intergenic
967123744 3:186406608-186406630 TTTCTAACAACATGTGACCTGGG + Intergenic
967368598 3:188716832-188716854 ATTCTAACATTTTGTGACTTAGG + Intronic
967433998 3:189423035-189423057 ATTCTAACACTATGTTGAATAGG - Intergenic
968315749 3:197723606-197723628 AATATAAAAATATGTAAAATGGG - Intronic
1202744840 3_GL000221v1_random:90284-90306 CTTCCAACACTATGTGGAATAGG + Intergenic
970049906 4:11902031-11902053 ATTCAAACAATATGTCCAAATGG + Intergenic
970120988 4:12752247-12752269 CTTCCAACAATATGTTGAATAGG - Intergenic
970684315 4:18548939-18548961 CTTCCAACACTATGTTAAATAGG + Intergenic
970906257 4:21219970-21219992 ATTTTAACAATATTTGAATTGGG + Intronic
970949141 4:21732124-21732146 ATTTTTAAAATATGTAAAATAGG + Intronic
971659798 4:29399002-29399024 ATTTAAAAAATATGTAAAATTGG + Intergenic
973049208 4:45574148-45574170 CTTCCAACACTATGTTAAATAGG - Intergenic
973096952 4:46214247-46214269 CTTCTAACACTATGTTAAATAGG - Intergenic
973108369 4:46369078-46369100 AATCTGGCAATATGGGAAATAGG + Intronic
973154256 4:46929923-46929945 ATACTAATAATATATGAAGTGGG + Intronic
973332087 4:48919883-48919905 CTTCCAACACTATGTTAAATAGG + Intergenic
973562073 4:52147193-52147215 AATCGAACAATATGTGATCTTGG + Intergenic
973860476 4:55059740-55059762 CTTCTAACACTATGTTGAATAGG - Intergenic
973935857 4:55845848-55845870 TTTCCAACACTATGTTAAATAGG - Intergenic
974119461 4:57621359-57621381 ATTCCAACACTATGTTGAATAGG + Intergenic
974143870 4:57922188-57922210 ATTCCAACACTATGTTGAATAGG - Intergenic
974480795 4:62440114-62440136 ATTCTAACTATATGACATATTGG - Intergenic
974516202 4:62915100-62915122 ATTCTTAGAATATGCTAAATTGG - Intergenic
974561240 4:63521736-63521758 ATTGAAACAATAGGTCAAATTGG - Intergenic
974770964 4:66413119-66413141 ATTCCAATATTATGTTAAATAGG + Intergenic
975162971 4:71144971-71144993 CTTCCAACACTATGTGGAATAGG + Intergenic
975232522 4:71951673-71951695 CTTCCAACACTATGTCAAATAGG - Intergenic
975249837 4:72165795-72165817 CTTCCAACACTATGTGGAATAGG + Intergenic
975309702 4:72889705-72889727 ATTTTAAGAATATGTTGAATTGG - Intergenic
975998861 4:80347297-80347319 CTTCTAACACTATGTTGAATAGG + Intronic
976446650 4:85137597-85137619 CTTCCAACAGTATGTGGAATAGG + Intergenic
976713075 4:88093901-88093923 GTTTTAACATTATGTGAAAACGG + Intronic
976765896 4:88597093-88597115 ATTCCAGCATTATTTGAAATAGG - Intronic
976996635 4:91441588-91441610 CTTCCAACACTATGTGGAATAGG - Intronic
977322995 4:95543464-95543486 ATTCAAACTATATTTGCAATAGG - Intronic
977456691 4:97270630-97270652 ATTCTCACACCATGTAAAATAGG + Intronic
977924885 4:102688684-102688706 AATCTCAAAATATGTAAAATAGG - Intronic
977998703 4:103529258-103529280 CTTCCAACACTATGTGGAATAGG - Intergenic
978046534 4:104135950-104135972 TTTCCAACACTATGTGGAATAGG + Intergenic
978231371 4:106404475-106404497 CTTCCAACACTATGTTAAATAGG + Intergenic
978475847 4:109128905-109128927 GTTATAACAATATGTGAAACTGG + Intronic
979048246 4:115896892-115896914 ATTCTAACCACATATGAAAGTGG + Intergenic
979441630 4:120757179-120757201 ATTATAACAGTAGGTAAAATTGG - Intronic
979471342 4:121101170-121101192 CTTATAACAATATCTGAAACTGG - Intergenic
979667892 4:123332679-123332701 CTTCTAATACTATGTTAAATAGG + Intergenic
979808378 4:125003611-125003633 GTTCTGACAATAGGTGAAAAGGG - Intergenic
980166696 4:129236763-129236785 TTTCTAACTATTAGTGAAATTGG - Intergenic
980393690 4:132179736-132179758 ATTATCACAATATTTAAAATTGG + Intergenic
980399204 4:132258102-132258124 CTTCTAACACTATGTTGAATAGG - Intergenic
980456481 4:133050395-133050417 CTTCTAATACTATGTTAAATAGG - Intergenic
980849108 4:138358848-138358870 CTTCTAACACTATGTTGAATAGG - Intergenic
980859252 4:138480219-138480241 CTTCCAACAATATGTTGAATAGG + Intergenic
980887736 4:138781641-138781663 CTTCCAACAATATGTTGAATAGG + Intergenic
980912514 4:139006458-139006480 ATTCATACAATATATGAAGTGGG + Intergenic
981140930 4:141268223-141268245 ATTCTAACAATGTCTAAAATGGG + Intergenic
981152972 4:141400290-141400312 CTTCCAACACTATGTGGAATAGG - Intergenic
981255124 4:142652338-142652360 CTTCTAACAGTATGTTGAATAGG - Intronic
981685625 4:147451415-147451437 TTTCTAACACTATGTTGAATAGG - Intergenic
981839112 4:149090620-149090642 CTTCCAACACTATGTTAAATAGG + Intergenic
981840474 4:149105861-149105883 ATTCAATCAATATGTAGAATCGG + Intergenic
981869767 4:149472088-149472110 CTTCCAACACTATGTTAAATAGG - Intergenic
981905710 4:149919510-149919532 ATTCCAACACTATGTTGAATAGG - Intergenic
982373796 4:154664270-154664292 AATCTAAAAATATGTTAATTGGG + Intronic
982874219 4:160625285-160625307 CTTCCAACAATATGTTGAATAGG - Intergenic
982899896 4:160985487-160985509 TATCTATCAAAATGTGAAATAGG + Intergenic
983244058 4:165267335-165267357 CTTCCAACACTATGTGGAATAGG + Intronic
983334267 4:166372508-166372530 CTTCCAACAGTATGTTAAATAGG + Intergenic
983364292 4:166766211-166766233 ATTCCAACACTATGTTGAATAGG + Intronic
983393147 4:167160008-167160030 CTTCCAACAATATGTTGAATAGG - Intronic
983401463 4:167271555-167271577 CTTCCAACAATATGTTGAATAGG - Intergenic
983687310 4:170426437-170426459 TTTTTAAAAATATATGAAATAGG - Intergenic
983740329 4:171123096-171123118 ATTCTATCACTATGTAAAAGTGG + Intergenic
983827621 4:172283819-172283841 ATTGTAATAAAATGTGTAATAGG - Intronic
983828056 4:172288897-172288919 ATTCAAATAGTATTTGAAATTGG - Intronic
983879436 4:172916364-172916386 ATTCCAACACTATGTTGAATAGG - Intronic
984040200 4:174723299-174723321 ATCCTAAAAATTTGTCAAATAGG - Intronic
984083981 4:175285475-175285497 ATTCAAAGAATTTGTGAAAATGG + Intergenic
984372773 4:178888043-178888065 ATTCCAACACTATGTTGAATAGG - Intergenic
984664905 4:182416106-182416128 ATTTGAATAATATGGGAAATGGG + Intronic
985148153 4:186916252-186916274 ATTCCAACAGTAATTGAAATTGG + Intergenic
985195998 4:187430191-187430213 ATTATAGTAATAAGTGAAATTGG - Intergenic
986380014 5:7174666-7174688 TTTCCAACAATATGTTGAATAGG - Intergenic
986811406 5:11363303-11363325 ATTCTAAGAACATGTGAATATGG + Intronic
987649847 5:20726556-20726578 CTTCCAACACTATGTTAAATAGG - Intergenic
987833214 5:23125635-23125657 ATTCTAATACTATGTTGAATAGG + Intergenic
988172370 5:27675423-27675445 AAGCTAACAATAAGTAAAATTGG - Intergenic
988369913 5:30355176-30355198 ATTCTACCAAAAAGTGAAATTGG + Intergenic
988658754 5:33241295-33241317 GTGCTGACAATATGTGAAGTGGG + Intergenic
988871953 5:35400195-35400217 CTTCCAACACTATGTTAAATAGG - Intergenic
989303865 5:39928670-39928692 ATACTAACAATATCTGCACTAGG + Intergenic
989680046 5:44017839-44017861 ATTCCAACACTATGTTGAATAGG - Intergenic
989831382 5:45923781-45923803 CTTCCAACACTATGTTAAATGGG + Intergenic
989838743 5:46031796-46031818 CTTCCAACAATATGTTGAATAGG - Intergenic
989843281 5:46108248-46108270 CTTCTAACACTATGTTAAATAGG + Intergenic
989994611 5:50813616-50813638 CTTCCAACACTATGTTAAATAGG + Intronic
990014017 5:51035819-51035841 ATGCTAACAATAGAGGAAATTGG + Intergenic
990783986 5:59398698-59398720 CTTCCAACACTATGTTAAATAGG - Intronic
991060232 5:62366953-62366975 ATTCTAAAAATAAGTGGAAATGG + Intronic
991132595 5:63141546-63141568 ATACTAACAATAGGGGGAATTGG - Intergenic
991175150 5:63679000-63679022 CTTCTAACACTATGTTGAATAGG + Intergenic
991280472 5:64907687-64907709 CTTCCAACACTATGTTAAATAGG + Intronic
991323737 5:65406170-65406192 CTTCCAACACTATGTTAAATAGG + Intronic
991500994 5:67277429-67277451 CCTCTAGCAATATGTTAAATAGG + Intergenic
991931913 5:71761606-71761628 ATTCCAACACTATGTTGAATAGG - Intergenic
992062596 5:73069844-73069866 ATCCTAACAATGGGTGAAAAAGG - Intronic
992131148 5:73694125-73694147 TTTCTTTCAAAATGTGAAATGGG - Intronic
993370682 5:87088521-87088543 CTTCCAACACTATGTTAAATAGG - Intergenic
994017538 5:94985627-94985649 ACTCTTAAAATATGTGAAGTGGG + Intronic
994030315 5:95134126-95134148 ATTCTATAAATAGGTGAGATTGG + Intronic
994112593 5:96023585-96023607 ATGCTAAAAACCTGTGAAATGGG + Intergenic
994349853 5:98732644-98732666 ATTCTAACCATATTTTAAATAGG + Intergenic
994604318 5:101947524-101947546 ATTCTCACAATGTGTACAATTGG + Intergenic
994788349 5:104191786-104191808 CTTCTAACACTATGTTGAATAGG - Intergenic
994917669 5:106001067-106001089 CTTCCAACACTATGTTAAATAGG + Intergenic
995093330 5:108206977-108206999 ATTCTCACAATGTGTAAAATTGG + Intronic
995345673 5:111114001-111114023 ATTCTAACTATATCTTAAAGTGG + Intronic
995805220 5:116044694-116044716 ATTCTAAAATCATATGAAATCGG - Intronic
996031507 5:118710735-118710757 ATTATAACATTATTTGTAATAGG + Intergenic
996854575 5:127990793-127990815 CTTCCAACACTATGTTAAATAGG + Intergenic
997325372 5:133016366-133016388 ATTTTAAAAATCTGTGAAATTGG - Intronic
998404532 5:141866675-141866697 AGTCTATGAATGTGTGAAATGGG + Intronic
998646808 5:144070928-144070950 CTTCCAACACTATGTTAAATAGG + Intergenic
998802213 5:145881147-145881169 CTTCCAACACTATGTTAAATAGG - Intergenic
998815685 5:146011904-146011926 CTTCCAACACTATGTTAAATAGG + Intronic
999916304 5:156266150-156266172 ATTTTAACAAAATTTTAAATTGG + Intronic
999963849 5:156786914-156786936 CTTCTAACACTATGTTTAATAGG - Intergenic
999980722 5:156955294-156955316 ATTATATGAATAAGTGAAATTGG - Intronic
1000768959 5:165326944-165326966 AATAAAACAATATTTGAAATAGG + Intergenic
1001212541 5:169823738-169823760 ATTCCAACACTATGTTGAATAGG - Intronic
1002572492 5:180150683-180150705 CTTCTAACACTATGTTGAATAGG - Intronic
1004627517 6:17390961-17390983 ATTCTAACCATAGGTTAAATAGG + Intergenic
1004905037 6:20229715-20229737 TTTCTAAGAATATTTGAATTGGG - Intergenic
1005152008 6:22762340-22762362 ATTCTAATACTATGTTGAATAGG + Intergenic
1005192300 6:23238785-23238807 ATACTAACAATAAGTGATTTGGG - Intergenic
1005274578 6:24202600-24202622 CTTCTAATACTATGTTAAATAGG - Intronic
1005543872 6:26843176-26843198 CTTCCAACACTATGTTAAATAGG + Intergenic
1005710448 6:28499289-28499311 ATTCTCAAAATATGAGAAGTAGG - Intergenic
1006563533 6:34934460-34934482 TTTATAACACTAGGTGAAATTGG + Intronic
1007199298 6:40092391-40092413 ATTCCAACATTATGTTGAATAGG + Intergenic
1008162652 6:48097850-48097872 TTTCTGAATATATGTGAAATAGG + Intergenic
1008287230 6:49668610-49668632 ATAATAACAAAATGTGAGATAGG - Intergenic
1008388121 6:50917857-50917879 CTTCCAACACTATGTGGAATAGG + Intergenic
1008414927 6:51228457-51228479 ATTCCAACACTATGTTGAATAGG - Intergenic
1008436496 6:51482391-51482413 CTTCCAACACTATGTTAAATAGG + Intergenic
1008490142 6:52077972-52077994 GTTCTAAACATCTGTGAAATAGG - Intronic
1008706886 6:54172955-54172977 AGGCTAACAATATGTTGAATAGG + Intronic
1008817757 6:55589519-55589541 CTTCTAACACTATGTTGAATAGG - Intergenic
1008924501 6:56877654-56877676 ATTCTAACAGGATATCAAATTGG + Intronic
1009014652 6:57884845-57884867 CTTCCAACACTATGTTAAATAGG + Intergenic
1009328766 6:62388109-62388131 ATTCTAAATAAATGTAAAATAGG + Intergenic
1009365045 6:62851504-62851526 AATATCACAATATGTGATATTGG - Intergenic
1009677441 6:66843817-66843839 CTTCCAACACTATGTTAAATAGG - Intergenic
1010113067 6:72265131-72265153 ATTCTAATAAAATATTAAATAGG + Intronic
1010482414 6:76371450-76371472 ATTCCAACACTATGTTGAATAGG + Intergenic
1010530576 6:76962951-76962973 ATTCCAACACTATGTTGAATAGG - Intergenic
1010758357 6:79693381-79693403 CTTCCAACACTATGTTAAATAGG + Intronic
1011085265 6:83533666-83533688 CTTCCAACACTATGTTAAATAGG - Intergenic
1011336635 6:86268556-86268578 ATTCCAACACTATGTTGAATAGG + Intergenic
1011339851 6:86302075-86302097 ATTCCAATAATATGTTGAATAGG + Intergenic
1011932427 6:92730939-92730961 CTTCCAACACTATGTGGAATAGG + Intergenic
1012184130 6:96192170-96192192 CTTCTAACACTATGTTGAATAGG - Intronic
1012516836 6:100071625-100071647 ATTCCAACACTATGTTGAATAGG + Intergenic
1013053523 6:106560728-106560750 ATTCTAAAAATAAATGTAATTGG + Intronic
1013518181 6:110908399-110908421 ATTCCAACACTATGTTGAATAGG - Intergenic
1013947947 6:115745102-115745124 ATTCCAACACTATGTTGAATAGG - Intergenic
1014146760 6:118007070-118007092 CTTATAACAATACTTGAAATTGG + Intronic
1014306492 6:119748969-119748991 CTTCCAACAATATGTTGAATAGG - Intergenic
1014387691 6:120821819-120821841 CTTCTAACACTATGTTGAATAGG - Intergenic
1014421293 6:121249071-121249093 AATCTAACAACATATCAAATAGG + Intronic
1014589594 6:123247220-123247242 CTTCCAACACTATGTTAAATAGG - Intronic
1014619870 6:123654121-123654143 ATTGTAATAATATAGGAAATAGG + Intergenic
1014881593 6:126730358-126730380 ATTCCAACACTATGTTGAATAGG - Intergenic
1015179901 6:130350189-130350211 CTTCTAACACTATGTTGAATAGG - Intronic
1015191765 6:130479623-130479645 CTTCTAACACTATGTTGAATAGG - Intergenic
1015290001 6:131528188-131528210 CTTCCAACACTATGTTAAATAGG + Intergenic
1015617736 6:135095408-135095430 ATGCTAACAATTTCTGAATTAGG + Intronic
1015693324 6:135951621-135951643 ATTCTAATAATAAGAAAAATAGG - Intronic
1015698091 6:136004320-136004342 CTTCCAACACTATGTTAAATAGG - Intronic
1015731852 6:136356968-136356990 ATTCTAACAATCTATGAAGTAGG - Intronic
1016246747 6:141991795-141991817 TAGCTACCAATATGTGAAATTGG - Intergenic
1016316158 6:142789733-142789755 ATTCAATCAATTTCTGAAATAGG - Intronic
1016404066 6:143711662-143711684 ATTCTAAGTATTTGTGAAATAGG - Intronic
1016520666 6:144943183-144943205 ATGTTAACAATAGGGGAAATTGG + Intergenic
1016724067 6:147340161-147340183 ATTCAAAGAATATGTGATAGAGG - Intronic
1016927242 6:149362914-149362936 ATTCTAACACTAGGGAAAATGGG - Intronic
1017412583 6:154184894-154184916 ATTATAACATTATCTGAAAGGGG - Intronic
1017818963 6:158035681-158035703 ATACTATTAATATGTTAAATAGG + Intronic
1018448571 6:163882654-163882676 CTTCTAATAATATGTTGAATAGG - Intergenic
1018661908 6:166095899-166095921 CTTCTAACACTATGTTGAATAGG + Intergenic
1020345907 7:7163433-7163455 CTTCCAACAATATGTTGAATAGG - Intronic
1020539334 7:9440494-9440516 CTTCCAACACTATGTTAAATAGG - Intergenic
1020757453 7:12221195-12221217 ATTCTAACTGTATATGAAGTTGG + Intronic
1020818426 7:12936094-12936116 CTTCTAACACTATGTTGAATAGG + Intergenic
1021282332 7:18736258-18736280 GTTCCAACACTATGTTAAATAGG + Intronic
1021354357 7:19635665-19635687 ATTCCAACACTATGTTGAATAGG - Intergenic
1021389272 7:20071902-20071924 ATTCCAACACTATGTTGAATAGG - Intergenic
1022140644 7:27490690-27490712 AATCTAACATAATGTGTAATTGG - Intergenic
1022638220 7:32157226-32157248 CTTCTAACTGTATTTGAAATAGG - Intronic
1024718179 7:52104597-52104619 CTTCCAACACTATGTTAAATAGG - Intergenic
1024969618 7:55056493-55056515 ATTCTAACAATATGTGAAATGGG - Intronic
1025030200 7:55550591-55550613 ATTCTTACAATATATAAAAACGG + Intronic
1025148048 7:56522134-56522156 ATTCTAACAAAATCGGAAAAGGG - Intergenic
1025597586 7:62950547-62950569 ATTCCAACACTATGTTGAATAGG - Intergenic
1026640505 7:72120472-72120494 ATTGCAACATTATGTAAAATTGG - Intronic
1027419845 7:78008288-78008310 ATTCTCACACTATATAAAATGGG - Intergenic
1027501960 7:78963544-78963566 GTTCTAACAACATGTAAACTGGG + Intronic
1027522863 7:79231817-79231839 CTTCTAACACTATGTTGAATAGG + Intronic
1027532825 7:79356131-79356153 ACAATAATAATATGTGAAATAGG + Intronic
1027786184 7:82581685-82581707 CTTCCAACACTATGTCAAATAGG + Intergenic
1028114902 7:86986028-86986050 CTTCTAACACTATGTTGAATAGG - Intronic
1028472231 7:91218227-91218249 CTTCCAACACTATGTTAAATAGG - Intergenic
1028643419 7:93069519-93069541 CTTCTAACACTATGTTGAATAGG + Intergenic
1028919208 7:96292397-96292419 CTTCCAACACTATGTTAAATAGG - Intronic
1029314913 7:99702861-99702883 ATTCTTACAATATGTAAACATGG + Intronic
1029503948 7:100950702-100950724 ACTCTGACAAATTGTGAAATGGG + Intronic
1030182582 7:106725731-106725753 CTTCTAACACTATGTTGAATAGG - Intergenic
1030449327 7:109689151-109689173 ATTCCAACACTATGTTGAATAGG + Intergenic
1030572221 7:111242001-111242023 CTTTAACCAATATGTGAAATAGG + Intronic
1031031997 7:116744896-116744918 ATTCCAACACTATGTTGAATAGG - Intronic
1031175556 7:118343897-118343919 CTTCTAACACTATGTTGAATAGG + Intergenic
1031285275 7:119858908-119858930 CTTCCAACAATATGTTGAATAGG - Intergenic
1031905403 7:127455057-127455079 CTTCTAACACTATGTTGAATAGG - Intergenic
1032994326 7:137428519-137428541 CTTCCAACACTATGTCAAATAGG - Intronic
1033403455 7:141049520-141049542 TTTCTGAAAATATGGGAAATAGG + Intergenic
1033902612 7:146161318-146161340 CTTCCAACAATATGTTGAATAGG - Intronic
1034368866 7:150576495-150576517 CTTCTAACACTATGTTGAATAGG + Intergenic
1035434844 7:158851981-158852003 ATTCTAAAAAGATGTGGCATTGG + Intergenic
1036152448 8:6311135-6311157 AGTCTAACAATATAGGAAAATGG - Intergenic
1036976522 8:13419238-13419260 CTTCTAACACTATGTTGAATAGG + Intronic
1036994889 8:13643877-13643899 ATTCCAACACTATGTTGAATAGG + Intergenic
1037081200 8:14788582-14788604 TTTCTACCACTATGTGAGATTGG - Intronic
1037545087 8:19912026-19912048 CTTCTAACACTATGTTGAATAGG + Intronic
1037634016 8:20684187-20684209 CTTCCAACACTATGTGGAATAGG + Intergenic
1037649132 8:20820806-20820828 ACCCCAGCAATATGTGAAATAGG - Intergenic
1037745431 8:21640407-21640429 ACTCTAACAGTATTTGAAGTGGG - Intergenic
1038506445 8:28089040-28089062 AATCTAACAAGATATCAAATAGG + Intergenic
1038508631 8:28108948-28108970 GTCCTAAGAATATGTGAAAGGGG + Intronic
1039128482 8:34231923-34231945 ATACATACAATATGTGATATTGG - Intergenic
1039169489 8:34726346-34726368 CTTCTAACACTATGTTGAATAGG - Intergenic
1039281143 8:35986321-35986343 CTTCTAACACTATGTTGAATAGG + Intergenic
1039441891 8:37600795-37600817 AGTCTCCCAATCTGTGAAATGGG - Intergenic
1040364499 8:46701286-46701308 CTTCCAACACTATGTTAAATAGG + Intergenic
1040716838 8:50265283-50265305 ATTCTAGTAATATGTGATACCGG - Intronic
1041213353 8:55575377-55575399 CTTCTAACACTATGTTGAATAGG - Intergenic
1041599982 8:59705576-59705598 CTTCTAACACTATGTTGAATAGG + Intergenic
1041843549 8:62299785-62299807 GTTTTAACAATATGTGAACACGG + Intronic
1042023873 8:64401883-64401905 CTTCCAACACTATGTTAAATAGG + Intergenic
1042208382 8:66352027-66352049 GTTCTAACAATATTTGAGTTTGG - Intergenic
1042523387 8:69738487-69738509 ATTCTAACAGTTTTTGAAACAGG - Intronic
1042686328 8:71444956-71444978 ATTCAAACCATGTGTGAAATTGG + Intronic
1043001370 8:74764083-74764105 ATTCCAATACTATGTTAAATAGG - Intronic
1043105891 8:76109450-76109472 ATTCCAACACTATGTGGAATAGG - Intergenic
1043120136 8:76312077-76312099 ATTCCAACACTATGTTGAATAGG - Intergenic
1043123815 8:76364104-76364126 CTTCCAACACTATGTTAAATAGG - Intergenic
1043250023 8:78060614-78060636 TTTCTAACACTATGTTGAATAGG - Intergenic
1043869924 8:85420871-85420893 CTTCCAACACTATGTCAAATAGG + Intronic
1044063904 8:87674539-87674561 AGTTTAACACTATGTTAAATAGG + Intergenic
1044313423 8:90722630-90722652 ATTGTAACAATAAGTAAAACTGG + Intronic
1044314226 8:90730781-90730803 ATTCCAACACTATGTTGAATAGG + Intronic
1044806663 8:96015449-96015471 ATTGCAACAACCTGTGAAATAGG - Intergenic
1045447295 8:102280582-102280604 ATTCTGAAAATGTTTGAAATTGG - Intronic
1045715397 8:105037624-105037646 CTTCTAACACTATGTTGAATAGG - Intronic
1046233305 8:111386864-111386886 ATTCTGACAATATGAAAAACAGG - Intergenic
1046292913 8:112185993-112186015 CTTCTAACACTATGTTGAATTGG - Intergenic
1046434245 8:114166718-114166740 CTTCCAACAATATGTTGAATCGG - Intergenic
1046496739 8:115024086-115024108 CTTCCAACAATATGTTGAATAGG + Intergenic
1046602279 8:116330621-116330643 ATTCCAACACTATGTTGAATAGG - Intergenic
1047247801 8:123159966-123159988 ATGCTAATAATATGTGAACCTGG - Intergenic
1047729899 8:127718929-127718951 TTTGTAACACAATGTGAAATGGG + Intergenic
1048092315 8:131254441-131254463 CTTCTAACACTATGTTGAATAGG - Intergenic
1048118076 8:131547466-131547488 ATTCCAACACTATGTTGAATAGG + Intergenic
1048413102 8:134196110-134196132 ATTCAAATTAAATGTGAAATTGG - Intergenic
1048449174 8:134517187-134517209 ATTCTAACTGTATATCAAATTGG - Intronic
1050003808 9:1106674-1106696 CTTCTAAAACTATGTCAAATAGG + Intergenic
1050336956 9:4598661-4598683 ATTTTAACAATAACTGAAATGGG + Intronic
1050840360 9:10141218-10141240 ATTCCAACACTATGTTGAATAGG - Intronic
1050954787 9:11641268-11641290 ATTATAAGACTATATGAAATTGG - Intergenic
1050995649 9:12213978-12214000 ATCCTCACAATATGTGAGGTGGG + Intergenic
1051324457 9:15949829-15949851 CTTCTAACACTATGTTGAATAGG + Intronic
1051746585 9:20300536-20300558 TTTCAAACAATATTTGAATTGGG - Intergenic
1051792178 9:20817942-20817964 ATTCTATCAATTTCTTAAATAGG - Intronic
1051860101 9:21615006-21615028 ATCTTAACAATAGGGGAAATTGG + Intergenic
1051982420 9:23038222-23038244 CTTCTAAAAATATGTCAAGTGGG + Intergenic
1052079861 9:24191170-24191192 ATTCTAACTATATGGCATATTGG - Intergenic
1052383236 9:27794381-27794403 CTTCCAACAATATGTTGAATAGG - Intergenic
1052598734 9:30596644-30596666 CTTCCAACACTATGTGGAATAGG - Intergenic
1052703354 9:31964282-31964304 CTTCCAACACTATGTTAAATAGG - Intergenic
1052992553 9:34528567-34528589 CTTCCAACACTATGTGGAATAGG + Intergenic
1053635860 9:40003091-40003113 ATTAAAACAATATTTGATATAGG - Intergenic
1053699729 9:40677736-40677758 CTTCCAACACTATGTGGAATAGG + Intergenic
1053770124 9:41461546-41461568 ATTAAAACAATATTTGATATAGG + Intergenic
1054311019 9:63477137-63477159 CTTCCAACACTATGTGGAATAGG + Intergenic
1054316739 9:63600194-63600216 ATTAAAACAATATTTGATATAGG - Intergenic
1054409804 9:64801288-64801310 CTTCCAACACTATGTGGAATAGG + Intergenic
1054548796 9:66373037-66373059 ATTAAAACAATATTTGATATAGG + Intergenic
1054708596 9:68487940-68487962 ATTTTTAAAATCTGTGAAATAGG + Intronic
1055351288 9:75391350-75391372 ATAGTAACAATAATTGAAATTGG + Intergenic
1055367334 9:75558750-75558772 AATCTACCAATAAGTGAAAAAGG + Intergenic
1055919917 9:81449427-81449449 AGGCTAACAATATATGAACTAGG + Intergenic
1056631658 9:88298634-88298656 ATTCCAACACTATGTTGAATTGG - Intergenic
1058079043 9:100682359-100682381 AGTCTTCCAATATATGAAATGGG - Intergenic
1058269994 9:102959934-102959956 AATCTAACATTATGCGTAATTGG - Intergenic
1058483478 9:105420250-105420272 ACTCTAACAAGAAGTAAAATAGG - Intronic
1059235105 9:112754279-112754301 ATTTGAACAATTTGAGAAATTGG - Intronic
1059623686 9:116037058-116037080 ATTTTCCCTATATGTGAAATGGG + Intergenic
1060750824 9:126167340-126167362 ATTATACCAATATGTTATATGGG - Intergenic
1061847389 9:133395304-133395326 ATGCTCACACTCTGTGAAATGGG + Intronic
1062645420 9:137545467-137545489 ATTTTAACAATAAGTGAGAACGG - Intronic
1203688546 Un_GL000214v1:20022-20044 CTTCCAACACTATGTGGAATAGG - Intergenic
1203690870 Un_GL000214v1:41520-41542 CTTCTAACACTATGTTGAATAGG + Intergenic
1203713468 Un_KI270742v1:120234-120256 CTTCCAACACTATGTGGAATAGG + Intergenic
1203645425 Un_KI270751v1:62671-62693 CTTCTAACACTATGTTGAATAGG - Intergenic
1203647729 Un_KI270751v1:84031-84053 CTTCCAACACTATGTGGAATAGG + Intergenic
1185958578 X:4520466-4520488 ATGCTAGCAATATCCGAAATGGG + Intergenic
1186534324 X:10330706-10330728 GTTAGAGCAATATGTGAAATGGG - Intergenic
1187318124 X:18217213-18217235 AATCTCACAAAATGTGAAATAGG + Intronic
1187627507 X:21132230-21132252 ATTGAAAAACTATGTGAAATGGG + Intergenic
1187705037 X:22001461-22001483 CTTCTAACACTATGTTGAATAGG + Intergenic
1188017282 X:25119160-25119182 ATTCCAACACTATGTTGAATAGG + Intergenic
1188452601 X:30324219-30324241 CTTCCAACACTATGTTAAATAGG + Intergenic
1188610322 X:32088099-32088121 ATTTTATCCATATGTTAAATTGG + Intronic
1188659537 X:32741990-32742012 ATTCTAAAAATATATTAAGTTGG - Intronic
1188677245 X:32956725-32956747 CTTCTAATACTATGTTAAATAGG + Intronic
1188716846 X:33469102-33469124 ATTGTAATAAGATGTTAAATTGG + Intergenic
1188974731 X:36659636-36659658 ATTTTAACCATACGTGAAAAGGG + Intergenic
1189171017 X:38909604-38909626 CTTCCAACACTATGTGGAATAGG - Intergenic
1189696780 X:43672467-43672489 ATTCCAACACTATGTTGAATAGG + Intronic
1190442634 X:50490645-50490667 CTTCCAACACTATGTTAAATAGG + Intergenic
1191120438 X:56898028-56898050 CTTCCAACACTATGTGGAATAGG - Intergenic
1191193139 X:57688367-57688389 CTTCCAACACTATGTGGAATAGG - Intergenic
1191567607 X:62559556-62559578 TTTCCAACACTATGTTAAATAGG - Intergenic
1191596466 X:62949686-62949708 CTTCCAACAATATGTTGAATTGG - Intergenic
1191756961 X:64603468-64603490 ATTCCAACAATATGTTGAATAGG + Intergenic
1192003865 X:67188484-67188506 CTTCCAACAATATGTTGAATAGG + Intergenic
1192701411 X:73478331-73478353 CTTCCAACAATATGTTGAATAGG + Intergenic
1192832359 X:74763991-74764013 TTTCTAACACTATGTTGAATAGG + Intronic
1192886809 X:75344131-75344153 GTTCTAATAGTATGTTAAATAGG + Intergenic
1192956189 X:76072787-76072809 CTTCCAACACTATGTTAAATAGG - Intergenic
1193033875 X:76928469-76928491 ATTCCAACACTATGTTGAATAGG - Intergenic
1193180348 X:78447610-78447632 CTTCCAACAATATGTTGAATAGG + Intergenic
1193189497 X:78552759-78552781 CTTCTAACACTATGTTGAATAGG - Intergenic
1193229626 X:79028619-79028641 CTTCTAACACTATGTTGAATAGG + Intergenic
1193362993 X:80598015-80598037 ATTCCAACACTATGTTGAATAGG + Intergenic
1193413906 X:81198845-81198867 CTTCCAACACTATGTTAAATAGG - Intronic
1193426042 X:81341902-81341924 ATTCCAACACTATGTTGAATAGG + Intergenic
1193635066 X:83939997-83940019 CTTCCAATAATATGTGAAATAGG + Intergenic
1194056747 X:89144564-89144586 CTTCTAATACTATGTCAAATGGG - Intergenic
1194073185 X:89353095-89353117 ATTGTAATAATATTTCAAATAGG - Intergenic
1195140490 X:101954310-101954332 CTTCTAACACTATGTTGAATAGG - Intergenic
1196075798 X:111574577-111574599 CTTCTAACACTATGTTGAATAGG + Intergenic
1196077174 X:111590722-111590744 CTTCTAACACTATGTTGAATAGG + Intergenic
1196148834 X:112349887-112349909 CTTCCAACACTATGTTAAATAGG + Intergenic
1196219851 X:113100475-113100497 CTTCTAATAGTATGTTAAATGGG + Intergenic
1197289789 X:124641362-124641384 AATATAGCAATATGTAAAATGGG + Intronic
1197382226 X:125758830-125758852 ATACTGAGAATATGTGCAATTGG + Intergenic
1197438659 X:126463241-126463263 CTTCCAACACTATGTGCAATAGG - Intergenic
1197991114 X:132318532-132318554 CTTCTAACACTATGTTGAATAGG - Intergenic
1198124131 X:133625283-133625305 CTTCTAACACTATGTTGAATAGG - Intronic
1198365739 X:135937876-135937898 CTTCTAACACTATGTTGAATAGG + Intergenic
1198584882 X:138109408-138109430 CTTCCAACACTATGTTAAATAGG - Intergenic
1198980277 X:142387614-142387636 ATTCCAACACTATGTTGAATAGG + Intergenic
1199479076 X:148277828-148277850 CTTCCAATACTATGTGAAATAGG - Intergenic
1199524545 X:148777875-148777897 ATTCCAACACTATGTTGAATAGG + Intronic
1200727416 Y:6688900-6688922 ATTGTAATAATATTTCAAATAGG - Intergenic
1200728568 Y:6704675-6704697 ATTGTAATAATATTTCAAATAGG - Intergenic
1200903308 Y:8455459-8455481 CTTCCAACAATATGTTGAATAGG + Intergenic
1200948950 Y:8873553-8873575 CTTCCAACACTATGTGGAATAGG + Intergenic
1200974577 Y:9195041-9195063 CTTCCAACACTATGTGGAATAGG + Intergenic
1201041671 Y:9839747-9839769 ATTCCAACACTATGTTGAATAGG + Intergenic
1201171431 Y:11270024-11270046 ATTCCAACACTATGTTGAATAGG + Intergenic
1201262188 Y:12170335-12170357 CTTCCAACACTATGTTAAATAGG + Intergenic
1201413639 Y:13726050-13726072 CTTCCAACATTATGTGGAATAGG - Intergenic
1201524223 Y:14913406-14913428 ATTCCAACACTATGTTGAATAGG + Intergenic
1201644911 Y:16219884-16219906 CTTCCAACACTATGTGGAATAGG + Intergenic
1201657903 Y:16365438-16365460 CTTCCAACACTATGTGGAATAGG - Intergenic
1201691343 Y:16768663-16768685 ATTCTAATAATATGTTGAATAGG + Intergenic
1201761760 Y:17547601-17547623 CTTCTAACACTATGTTGAATAGG - Intergenic
1201778370 Y:17691378-17691400 CTTCCAACACTATGTGGAATAGG + Intergenic
1201823186 Y:18214614-18214636 CTTCCAACACTATGTGGAATAGG - Intergenic
1201839792 Y:18358389-18358411 CTTCTAACACTATGTTGAATAGG + Intergenic
1201923361 Y:19258520-19258542 CTTCCAACAATATGTTGAATAGG - Intergenic
1201941945 Y:19469539-19469561 CTTCCAACAATATGTTGAATAGG + Intergenic
1201970025 Y:19781907-19781929 ATTCTAACACTATGTTGAATAGG - Intergenic
1201970964 Y:19794394-19794416 CTTCCAACAGTATGTTAAATAGG + Intergenic
1202040545 Y:20678578-20678600 CTTCTAACACTATGTTGAATAGG - Intergenic