ID: 1024969716

View in Genome Browser
Species Human (GRCh38)
Location 7:55057365-55057387
Sequence TTATGAGATGCTTAATTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 4, 3: 9, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024969716_1024969721 24 Left 1024969716 7:55057365-55057387 CCTCTTAATTAAGCATCTCATAA 0: 1
1: 0
2: 4
3: 9
4: 205
Right 1024969721 7:55057412-55057434 GAAGTCACTTTATTTATGTGTGG 0: 1
1: 0
2: 1
3: 21
4: 223
1024969716_1024969722 25 Left 1024969716 7:55057365-55057387 CCTCTTAATTAAGCATCTCATAA 0: 1
1: 0
2: 4
3: 9
4: 205
Right 1024969722 7:55057413-55057435 AAGTCACTTTATTTATGTGTGGG 0: 1
1: 0
2: 2
3: 19
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024969716 Original CRISPR TTATGAGATGCTTAATTAAG AGG (reversed) Intronic
901753790 1:11428643-11428665 TAATGAGATGGTTCATTATGAGG + Intergenic
902260483 1:15221390-15221412 TTATGCGATGCATTATTAAAAGG + Intergenic
905728794 1:40279573-40279595 TGTTGAGATGCTTGAATAAGTGG + Intronic
906653767 1:47533326-47533348 ATATGTAATGCTTTATTAAGCGG - Intergenic
906928473 1:50144508-50144530 TTATGAGATAGTTAATAAACAGG + Intronic
908946761 1:69507849-69507871 TGATGAGAAACTGAATTAAGTGG + Intergenic
910489971 1:87757801-87757823 TTATGAGAAACATTATTAAGAGG + Intergenic
910963635 1:92786215-92786237 TTCTGAAATGCTTAGTTCAGTGG - Intronic
911883458 1:103269615-103269637 TTATCATAAGCTTAATCAAGTGG + Intergenic
912921636 1:113873618-113873640 TTCTGAGTTGCTTTATTAACTGG - Intergenic
917976543 1:180243473-180243495 TTATTACAGGTTTAATTAAGAGG + Intronic
921420702 1:214944415-214944437 TTATGACCTGCTTGATAAAGGGG + Intergenic
922967987 1:229708111-229708133 TTATGACATACTTATTTATGGGG - Intergenic
923898510 1:238300009-238300031 ATATGAAATGATTAATTCAGGGG - Intergenic
923973719 1:239235591-239235613 TGATGATATGCTAAAATAAGGGG + Intergenic
1064955768 10:20907634-20907656 ATATGAGATTTTTAATAAAGAGG + Intronic
1066382644 10:34914267-34914289 TTATGAGATGCTTGAGGAAATGG - Intergenic
1067333040 10:45339377-45339399 TTATCATAAGCTTAACTAAGTGG + Intergenic
1067918713 10:50429494-50429516 TACTGAGTTGCTTAATTATGAGG - Intronic
1068128949 10:52873633-52873655 CTATTAGATGTTTGATTAAGTGG - Intergenic
1068216456 10:53988576-53988598 TTATGAGTGGCTTAATTTAGAGG + Intronic
1071083900 10:81845575-81845597 TTATGTGATTTTTAATTAATAGG + Intergenic
1072209375 10:93232517-93232539 TTATCACAAGCTTAATCAAGTGG - Intergenic
1073830588 10:107378831-107378853 TTGTTACAAGCTTAATTAAGTGG - Intergenic
1073957774 10:108892478-108892500 TTATGGTAAGCTTAACTAAGCGG - Intergenic
1076123099 10:127951884-127951906 TTATGATAAGCTTAACCAAGTGG + Intronic
1077744453 11:4885641-4885663 TCATGAGTTGCTTAATAAGGGGG - Intronic
1079301393 11:19282354-19282376 TTATGAGATGCTCTATGGAGAGG + Intergenic
1083374899 11:62211771-62211793 TCATGAGGCACTTAATTAAGTGG - Intronic
1086804537 11:91223917-91223939 TTATGAGACTTTTAATTAATGGG + Intergenic
1087564069 11:99831315-99831337 TGTTGAGATGCTTAACGAAGTGG + Intronic
1090305095 11:125684390-125684412 TAATGAGATGATTCATGAAGTGG - Intergenic
1091472950 12:745796-745818 TTAAAAAATGCTTAAATAAGGGG - Intergenic
1093046133 12:14447105-14447127 TTAGGAAATGCTGAATTAGGAGG + Intronic
1095554959 12:43491387-43491409 TTATGTGTTGCTTAATGACGGGG - Intronic
1096547330 12:52349479-52349501 TTCTGATATGCTTTCTTAAGCGG + Intergenic
1097481753 12:60135636-60135658 ATATGAGATGCTTATATTAGGGG - Intergenic
1097678343 12:62626253-62626275 TTGTGAGATGCTCAACAAAGAGG - Intergenic
1098416028 12:70236425-70236447 TTAGCAGATGCTAAACTAAGTGG + Intergenic
1099365816 12:81764527-81764549 TTATCATAAGCTTAACTAAGTGG + Intergenic
1099526268 12:83722266-83722288 TTATCATAAGCTTAACTAAGTGG + Intergenic
1100899141 12:99218390-99218412 TTATGAGATTCTTTGCTAAGTGG + Intronic
1103038774 12:117677695-117677717 TTATGAGATTCTTATTCTAGCGG + Intronic
1104315203 12:127692414-127692436 GTGTGAGATGCTTAAATCAGAGG - Intergenic
1106586651 13:31062998-31063020 TTATGAAATGCTTAATAAAATGG + Intergenic
1107437398 13:40392190-40392212 TTTTGAGTTGCTTATTTAATAGG - Intergenic
1107861126 13:44661706-44661728 TTATGAGATACGTAAAGAAGTGG - Intergenic
1108740813 13:53336379-53336401 TTATAGGATGTTTAATGAAGTGG - Intergenic
1109034956 13:57245124-57245146 TTCTGAAATGATTTATTAAGAGG - Intergenic
1109490391 13:63090331-63090353 TCATAAGATCCTTAATTGAGAGG + Intergenic
1109509081 13:63345425-63345447 TTATGAAAAGCATAATTAAGAGG - Intergenic
1110118277 13:71847303-71847325 TTATGAAATTCATAATTATGGGG - Intronic
1110262404 13:73500299-73500321 TTATGTCATGCTTATTTCAGAGG + Intergenic
1110948019 13:81448468-81448490 TTATGACATGCCAAATAAAGAGG - Intergenic
1111762458 13:92482825-92482847 TTATGCCATGCTTAATGATGGGG + Intronic
1112231335 13:97591628-97591650 TAATGAGATCCTTCCTTAAGGGG + Intergenic
1114845565 14:26316388-26316410 TTATGACAAACTTAATTATGTGG + Intergenic
1115783281 14:36795024-36795046 TTATGACTTTCTCAATTAAGGGG + Intronic
1116014006 14:39384955-39384977 TTATGAGATGCTCCATTTAATGG + Intronic
1118079730 14:62344621-62344643 TTATGTGATGCTTACTGATGGGG + Intergenic
1118704103 14:68464219-68464241 TGATGAGATGCTGAATTGATGGG - Intronic
1119287030 14:73463565-73463587 TTGTGAGATGCTCAACGAAGAGG - Intronic
1120379782 14:83762056-83762078 TTTTAAGCTGCATAATTAAGTGG - Intergenic
1126169928 15:45686716-45686738 TTATAAAATGCTTATTAAAGTGG - Intronic
1130346458 15:83051255-83051277 TTATGATATGGTTAACTAATTGG - Intronic
1132035784 15:98482949-98482971 TTACAACATGGTTAATTAAGTGG + Intronic
1134324225 16:13192408-13192430 TTATGAAATTCTTTAGTAAGTGG + Intronic
1134887714 16:17808639-17808661 TTATCAGTTCCTTAATTATGGGG + Intergenic
1135102574 16:19619287-19619309 TTTTGAGATTCTAAATTATGAGG + Intronic
1135342689 16:21662868-21662890 TAATGAAATGCTTAAATAAATGG - Intergenic
1138684564 16:58713682-58713704 ATATGAGCTGCTTAGTTGAGAGG - Intronic
1140597012 16:76428174-76428196 TAATAAAATGCTTCATTAAGAGG - Intronic
1141749773 16:85950555-85950577 TTATAAAATGCTGAAATAAGGGG - Intergenic
1146912088 17:36655376-36655398 TTATGGACTGCTTATTTAAGAGG - Intergenic
1148348455 17:46920651-46920673 TTAGGAGAGACTTAATGAAGGGG - Intergenic
1148619505 17:49023636-49023658 TTAAGAGAGGCTTAATTAGAGGG + Intronic
1149368572 17:55969959-55969981 TTGAGAGATGTTTAAATAAGTGG + Intergenic
1151067151 17:71163444-71163466 TTATGTGATGCTTAAATGACAGG + Intergenic
1155196186 18:23476961-23476983 TTAGGAAATGAATAATTAAGTGG - Intronic
1156134617 18:34022459-34022481 TTCTGAAATGCAGAATTAAGGGG + Intronic
1156345680 18:36255224-36255246 TTCTGAGACGCTTAAATAAAGGG + Intronic
1156440571 18:37183238-37183260 TTATGAAATGGCTAATTATGAGG - Intronic
1157471195 18:47990378-47990400 TTATGTGATACTGTATTAAGTGG + Intergenic
1157897353 18:51481808-51481830 TTATGAGATTCTTATTTATTAGG + Intergenic
1158062357 18:53360880-53360902 TTCTGAGATGCTTCTTTAAAAGG + Intronic
1158964843 18:62613082-62613104 TTTTGAGATGCTTTCTTTAGTGG - Intergenic
1159575747 18:70174661-70174683 TTATGAAGTGTTTAATTAAATGG + Intronic
925602075 2:5618331-5618353 AGATGATATGCTTTATTAAGAGG + Intergenic
928030721 2:27776487-27776509 TTATGAAATGCTCAAATAATTGG - Intronic
930398882 2:50857763-50857785 GTATTAGATGCTAAATTAAAAGG - Intronic
930847437 2:55921097-55921119 TTATGAGATGATTATAAAAGTGG + Intronic
930989566 2:57636127-57636149 TTTTAAAATGCTTAATTAAATGG + Intergenic
931381072 2:61753889-61753911 TTATGATATTATTAAATAAGAGG - Intergenic
931495443 2:62801839-62801861 ATAGGAGATGCTTAATAAATTGG - Intronic
932403985 2:71501367-71501389 TGTTGAGAAGCTTAAATAAGTGG + Intronic
932951448 2:76298851-76298873 TTAGGATATTCCTAATTAAGGGG - Intergenic
933510454 2:83234500-83234522 TTATGAGAAGATTCTTTAAGAGG - Intergenic
935183909 2:100714688-100714710 TTATCATAAGCTTAATCAAGTGG + Intergenic
938610432 2:132941949-132941971 TTACAAGATGCTAAATAAAGGGG + Intronic
939366669 2:141242101-141242123 ATATGAGATGCTTTAATAAAAGG + Intronic
939957718 2:148540575-148540597 TCCGTAGATGCTTAATTAAGAGG + Intergenic
941301287 2:163805620-163805642 TTATCAGATAGTTAATTAAGTGG - Intergenic
943870942 2:192998242-192998264 TTATGTGATGTGTTATTAAGGGG + Intergenic
944991425 2:205241233-205241255 TCATAAGGTGCTTAATAAAGAGG - Intronic
945686373 2:212975460-212975482 TTCTGAGCTGCTTAAACAAGTGG + Intergenic
946568350 2:220993172-220993194 TTATGTGTTGCTTAATGATGGGG + Intergenic
947513986 2:230785326-230785348 TTTTGAGAGGTTTAATTATGAGG + Intronic
1170999961 20:21404429-21404451 TTATAAGATCCTTATTTATGAGG - Intergenic
1171792515 20:29540703-29540725 CTATGAGATGCTCTTTTAAGTGG - Intergenic
1171855958 20:30343678-30343700 CTATGAGATGCTCTTTTAAGTGG + Intergenic
1172214897 20:33228335-33228357 CTAGGAGATGCTTTATAAAGTGG - Intergenic
1173152409 20:40578828-40578850 TTATGAGAGGGTTAAGCAAGAGG + Intergenic
1176888075 21:14280925-14280947 TTTTGAGATACTTATTGAAGGGG + Intergenic
1176917106 21:14639084-14639106 TTATGAGATACAAAATGAAGTGG + Intronic
1178786058 21:35654746-35654768 TTACGAGAATCTTAATGAAGAGG + Intronic
949122028 3:397400-397422 TTATGAAATGCTATTTTAAGTGG - Intronic
949125772 3:444013-444035 TTATCATAAGCTTAACTAAGCGG - Intergenic
949269906 3:2202771-2202793 TTATTAGGTGCTTATTTAACCGG + Intronic
951165421 3:19480047-19480069 TTATGAGATTCCTTATTGAGAGG + Intronic
959087724 3:101869025-101869047 TTCTGAGCTGCTAAATTTAGGGG + Intergenic
959645153 3:108690943-108690965 TTATGAGCTGCTTGTTTGAGTGG + Intronic
960129545 3:114040326-114040348 TCATGTGTTGCTTAATGAAGAGG - Intronic
960323572 3:116267194-116267216 ATAAGAGATGCTCATTTAAGAGG + Intronic
963661284 3:148131278-148131300 TTATCATATGCTTAACCAAGTGG + Intergenic
963851980 3:150218203-150218225 TTTTGAGATGCTAAATTCTGGGG + Intergenic
963860047 3:150299985-150300007 TTATGTGAGGCTGAATTAGGAGG + Intergenic
964328811 3:155577486-155577508 TTTTGTGGTGCTTAATAAAGTGG + Intronic
964780610 3:160332912-160332934 TCATGTGTTGCTTAATGAAGGGG + Intronic
965024475 3:163283106-163283128 CTATGAACTGCTTATTTAAGAGG + Intergenic
965095594 3:164220843-164220865 TTATGAGATGCTTTATTCTAAGG + Intergenic
967752898 3:193134717-193134739 TTTTGTGATGCTTGAGTAAGTGG + Intergenic
968268007 3:197377524-197377546 TTATCAGCTGCTTAATTAAGGGG - Intergenic
970956786 4:21821822-21821844 TTATAAGAGGCTTAATGAATAGG - Intronic
972901822 4:43694802-43694824 CTTTAAGATGCTTAATTAGGTGG + Intergenic
972975896 4:44635561-44635583 TTATGAAGTGCTTCATTAACAGG + Intronic
975049727 4:69846102-69846124 TAATGAGTTTCTTTATTAAGAGG - Intronic
977490182 4:97700930-97700952 TTATTATAAGCTTAATCAAGTGG - Intronic
978625191 4:110677298-110677320 TTAGGAGGTGGTTAATTTAGGGG + Intergenic
978660721 4:111123022-111123044 TGATAAGATGATTCATTAAGTGG + Intergenic
981370854 4:143957130-143957152 TTTTGAGAGGCTGAATTGAGTGG - Intergenic
981804929 4:148704064-148704086 TTATAAAATGCTTATTAAAGAGG - Intergenic
982412828 4:155098410-155098432 TTATGAGTTTTTTAATTAAGAGG + Intergenic
982847659 4:160273428-160273450 TTATCATAAGCTTAATAAAGTGG + Intergenic
986381664 5:7192672-7192694 ATATGAGCTGCTCATTTAAGGGG - Intergenic
987904610 5:24059815-24059837 TAATGGGATGCTTAAATATGGGG - Intronic
988057867 5:26123820-26123842 TTATAAGATGCAAAATTAGGAGG + Intergenic
988168076 5:27619576-27619598 TTATTACATGCTTAATTACATGG - Intergenic
988184350 5:27840628-27840650 TTATAAGATGCTTAAAAGAGGGG + Intergenic
988686408 5:33529834-33529856 TTATAAGAGGCTTAAAGAAGAGG - Intronic
989457752 5:41662633-41662655 TTATCATATGCTTAACCAAGTGG - Intergenic
989486488 5:41997237-41997259 TTATCATAAGCTTAATCAAGTGG - Intergenic
989751392 5:44898516-44898538 TTATGAGAAGATTAGTGAAGTGG - Intergenic
990065254 5:51705152-51705174 TAATCAGAGGCTTTATTAAGTGG - Intergenic
991153736 5:63403791-63403813 AAATAAGATTCTTAATTAAGAGG + Intergenic
991217095 5:64167567-64167589 GTATGAGGTGCTTATTAAAGAGG - Intronic
993346957 5:86795994-86796016 TTCTGAGATGATTAATTGGGAGG + Intergenic
994520847 5:100832923-100832945 TCATGAGATACTTCATTAAAAGG - Intronic
994793741 5:104266088-104266110 TTGTGAGATGGTTAATTATGCGG + Intergenic
995469603 5:112486867-112486889 TTATGTGTTGCTTAATGATGGGG + Intergenic
996613199 5:125409194-125409216 TTATGACAAGATTAATTAAAGGG - Intergenic
997779380 5:136641459-136641481 TTCTGATCTGGTTAATTAAGTGG - Intergenic
1003073210 6:2960669-2960691 TGAGGAGATGCTGAATTAAGCGG + Exonic
1004482444 6:16033659-16033681 TTCTGAGATGCTGATTCAAGTGG - Intergenic
1004490924 6:16115163-16115185 TTATAAGATGTTAAATTTAGAGG + Intergenic
1008266516 6:49434344-49434366 TTGTGAGATTCGTAATAAAGTGG - Intronic
1008554234 6:52659258-52659280 TTCTGAGATGCTTAATTCAGTGG - Intergenic
1008892528 6:56511653-56511675 GTATGAGATGCATAATAAACTGG - Intronic
1010038410 6:71353101-71353123 TTCTGGGAGACTTAATTAAGGGG - Intergenic
1010295136 6:74186560-74186582 TCATGAGTTTCTTAAATAAGAGG - Intergenic
1010818518 6:80387535-80387557 TTATCATAAGCTTAACTAAGTGG + Intergenic
1010832885 6:80552507-80552529 TTATGAGTTGCTTAATCACAAGG - Intergenic
1011888293 6:92125587-92125609 TTTTGACATGCTTAATTATCTGG + Intergenic
1012304967 6:97643729-97643751 TTATGAGAGGCTGATTTAAAAGG + Intergenic
1012487878 6:99742485-99742507 TTATGAAATGCTTGATAAAAAGG - Intergenic
1012842497 6:104346938-104346960 TGTTGAGATGCTTGAATAAGTGG - Intergenic
1013300236 6:108798405-108798427 TTATCTGATGCTAAATTATGTGG + Intergenic
1014792413 6:125688850-125688872 TGTTGAGATGCTTAAAGAAGTGG + Intergenic
1023244978 7:38192666-38192688 TTATGAGATTATTTATTAAATGG - Intronic
1024969716 7:55057365-55057387 TTATGAGATGCTTAATTAAGAGG - Intronic
1025738605 7:64177140-64177162 TTATTAGAAAGTTAATTAAGTGG + Intronic
1027399794 7:77795779-77795801 TTATTAGATGCTAAATTTTGGGG + Intronic
1027433538 7:78139781-78139803 TTATGAGATTTTCAATTAAAAGG - Intronic
1028109224 7:86918935-86918957 TTCTTGGATGCTTAATGAAGAGG - Intronic
1028141632 7:87281114-87281136 TTATCATAAGCTTAACTAAGTGG + Intergenic
1028349878 7:89832937-89832959 TTCTGAAATGCTTATTTATGAGG + Intergenic
1031068008 7:117128438-117128460 TTCAGAGATGCTAAATTAAGTGG + Intronic
1036950797 8:13137348-13137370 GTTTGAGATGCTAAACTAAGAGG + Intronic
1041406823 8:57508741-57508763 TTCTGACATTCTTAATTGAGTGG + Intergenic
1041986072 8:63923603-63923625 TTATTAGAAGCTTAACCAAGTGG + Intergenic
1043101296 8:76050219-76050241 TTTGGAGATGATAAATTAAGTGG - Intergenic
1044807138 8:96020095-96020117 TTATGAGTTGCTTAATGACGGGG - Intergenic
1045377432 8:101588617-101588639 TTTTGAGTTGCTTAAGTAATTGG + Intronic
1048564812 8:135584481-135584503 ATAATAGATGCTAAATTAAGTGG - Intronic
1052130013 9:24832301-24832323 CTAAGATATGGTTAATTAAGGGG + Intergenic
1052722245 9:32186166-32186188 TTATGAGATGCTGAATTTCATGG + Intergenic
1055167111 9:73210377-73210399 TGTTGAGATGCTTAAAGAAGTGG - Intergenic
1055895535 9:81170338-81170360 TTATTAGATACTTTTTTAAGTGG - Intergenic
1056133851 9:83611318-83611340 TTTTGAGAAGCTTAATTATCTGG + Intergenic
1057480702 9:95443010-95443032 TTATGTGATGCCTAATAATGAGG - Exonic
1058064797 9:100537291-100537313 TTATGAGATACTGAATTTGGAGG + Intronic
1058182215 9:101812284-101812306 TTCTAAGATGCTTATTTATGAGG + Intergenic
1058592227 9:106577011-106577033 TTGTGAAAGGCTTAATTTAGGGG - Intergenic
1060164458 9:121398451-121398473 CTATGAGCTGCTTCTTTAAGGGG + Intergenic
1186295920 X:8148143-8148165 TTATGAAATGTTTTATTAAAGGG - Intergenic
1186429434 X:9492079-9492101 TTATGAAATACTTCTTTAAGGGG + Intronic
1186472657 X:9833513-9833535 TTATGAGGTCCCTAATTAGGAGG - Intronic
1188294109 X:28424996-28425018 TGCTGAGATGCTTAAAGAAGTGG - Intergenic
1191873037 X:65765845-65765867 TTATTAGGTGCTGAATTAATAGG + Intergenic
1192911766 X:75612305-75612327 TTATGAGGTGCTTCAGGAAGAGG + Intergenic
1193024596 X:76831904-76831926 TTATGTGGTGCTTAAATAATGGG - Intergenic
1193569574 X:83126433-83126455 ATATGAAATGCATAATTTAGTGG - Intergenic
1194195909 X:90892620-90892642 TGATGAGATGCTTCATTAAGGGG + Intergenic
1194659332 X:96612193-96612215 TAATGAGAAGCATAATTGAGTGG - Intergenic
1195501869 X:105611719-105611741 TTATGTGTTGCTTAATGATGGGG - Intronic
1197321823 X:125041808-125041830 TTATGAGATGTACTATTAAGTGG - Intergenic
1197632964 X:128883381-128883403 TTATGTGTTGCTTAACAAAGAGG - Intergenic
1199021152 X:142880229-142880251 TTATCATAAGCTTAATTATGTGG + Intergenic
1199139551 X:144293730-144293752 TAAAGAAATGCATAATTAAGGGG - Intergenic
1200541757 Y:4466813-4466835 TGATGAGATGCTTCATTAAGGGG + Intergenic