ID: 1024971473

View in Genome Browser
Species Human (GRCh38)
Location 7:55075296-55075318
Sequence AGTGAATGAAAAGTGGCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 376}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024971473_1024971476 0 Left 1024971473 7:55075296-55075318 CCGGTGGCCACTTTTCATTCACT 0: 1
1: 0
2: 1
3: 23
4: 376
Right 1024971476 7:55075319-55075341 CTGAACCCTTCTTTGTATGGAGG 0: 1
1: 0
2: 1
3: 17
4: 144
1024971473_1024971475 -3 Left 1024971473 7:55075296-55075318 CCGGTGGCCACTTTTCATTCACT 0: 1
1: 0
2: 1
3: 23
4: 376
Right 1024971475 7:55075316-55075338 ACTCTGAACCCTTCTTTGTATGG 0: 1
1: 0
2: 1
3: 8
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024971473 Original CRISPR AGTGAATGAAAAGTGGCCAC CGG (reversed) Intronic
903906867 1:26694003-26694025 TGTGAGTGAAAAGAGGGCACTGG + Intergenic
904380801 1:30109402-30109424 AGTGAGTGTGAAGTGGCCAGAGG - Intergenic
905227547 1:36489064-36489086 AGAGAAGGAAAAGTGGGCCCAGG + Intergenic
907210489 1:52817266-52817288 GGTGAATGAGAATTGGGCACCGG - Intronic
907465849 1:54636209-54636231 AGAGAAAGAAAAGTGGGCCCAGG + Exonic
907580740 1:55570313-55570335 AATGGATCAAAAGTGGCCATAGG + Intergenic
908022751 1:59915253-59915275 AGAGAAAGAAAAGTGGGCCCAGG - Intronic
908508762 1:64833269-64833291 AGTGCATATAGAGTGGCCACAGG + Exonic
908967077 1:69778248-69778270 AGAGAATGAATAATTGCCACAGG - Intronic
909522740 1:76588163-76588185 AGTGAATGCTTAGTAGCCACAGG + Intronic
909559259 1:76991499-76991521 ATTGAATGAGAAGTGGTCAGGGG - Intronic
910807649 1:91204642-91204664 AGTGAAGGTAAAGTGGGAACAGG + Intergenic
911947779 1:104134832-104134854 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
912114036 1:106382162-106382184 AGTGACAGAAAAGCTGCCACTGG - Intergenic
912642370 1:111359813-111359835 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
912856752 1:113176000-113176022 AGTGGTTGAAATATGGCCACTGG + Intergenic
913277310 1:117151487-117151509 AGGGAATAAAAGCTGGCCACTGG - Intronic
914393255 1:147240952-147240974 AGAGAAAGAAAAGTGGGCCCAGG - Intronic
914745802 1:150500202-150500224 AAGGACTGAAAAGTGTCCACTGG + Intronic
914975428 1:152356565-152356587 AGAGTTTGAAAAGCGGCCACAGG + Exonic
914985674 1:152455201-152455223 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
916005105 1:160652993-160653015 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
916039328 1:160948917-160948939 AGAGAAAGAAAAGTGGGCCCAGG + Intronic
916630275 1:166605457-166605479 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
917042921 1:170826204-170826226 AGTGAATTGAAAGTGGCAAGTGG - Intergenic
917703522 1:177605667-177605689 AGTGACTGAAAAGAGGCACCAGG + Intergenic
918665485 1:187145917-187145939 ACTGATTGAAAAGTGGCCAAAGG - Intergenic
919326053 1:196108825-196108847 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
919348614 1:196419028-196419050 AGTGAAGGAGAAGTAGCCTCAGG - Intronic
919484451 1:198129775-198129797 AGAGAAAGAAAAGTGGGCGCAGG + Intergenic
922528018 1:226321174-226321196 AGGGAATAAAAGCTGGCCACCGG + Intergenic
923440258 1:234011903-234011925 AGAGAAAGAAAAGTGGGCCCAGG + Intronic
924667034 1:246083521-246083543 AGAGAAGGAAAAGTGGGCGCAGG - Intronic
1063724009 10:8616533-8616555 AGTAAATGAAAAATGAGCACGGG - Intergenic
1064834409 10:19509900-19509922 AGAGAAAGAAAAGTGGGCCCAGG + Intronic
1065111478 10:22444478-22444500 AGTGAATGAAGATTGTCCTCAGG + Intronic
1065500488 10:26376977-26376999 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1065548947 10:26851160-26851182 AGTGAATGAAAAGTGGGAGATGG + Intronic
1066045031 10:31587388-31587410 AGGGAATAAAAGCTGGCCACCGG - Intergenic
1066293288 10:34033276-34033298 AGGGGATGAGGAGTGGCCACAGG + Intergenic
1067542667 10:47166985-47167007 AGGGAATAAAAGCTGGCCACCGG + Intergenic
1068515139 10:58016744-58016766 TGTGAATGAATAAAGGCCACAGG - Intergenic
1072210418 10:93241209-93241231 AGTGAATGAAAATAGGTCAAGGG + Intergenic
1073532896 10:104249045-104249067 AGGGAATAAAAGCTGGCCACCGG + Intronic
1073933214 10:108600078-108600100 AGTGCCTGAAATCTGGCCACTGG + Intergenic
1074093390 10:110284959-110284981 AGTGAATGAAAGTTTGACACTGG - Exonic
1076932382 10:133541143-133541165 AGAGAAAGAAAAGTGGGCCCAGG + Intronic
1077444827 11:2586099-2586121 GTTGAATGACAAGTGCCCACTGG + Intronic
1078400044 11:11017953-11017975 AATGAATGGAAAGTGGACTCTGG + Intergenic
1078487310 11:11735607-11735629 AATGAAAGAAATGTGGCCTCGGG + Intergenic
1078711786 11:13799492-13799514 AGTGAAAGATAAGAGGCCAGTGG + Intergenic
1078943244 11:16032975-16032997 AGTGAATGAAAAGTGTCGTAAGG - Intronic
1080518896 11:33049436-33049458 AGAGAAAGAAAAGTGGGCCCAGG + Intronic
1081014585 11:37859787-37859809 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1081291885 11:41336576-41336598 GGTGAATGAAAAGTGGATAGAGG - Intronic
1081938275 11:46919157-46919179 AGTGAATGAAAAGGGGCGGGGGG - Intergenic
1082673025 11:56058508-56058530 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1082716303 11:56618411-56618433 AGAGAAAGAACAGTGGCCCCAGG + Intergenic
1082969618 11:59005610-59005632 AGAGAAAGAAAAGTGGGCCCGGG - Intronic
1082982592 11:59137162-59137184 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1083040643 11:59682020-59682042 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1083388109 11:62327451-62327473 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1083534420 11:63455185-63455207 AGTGATGGAAATCTGGCCACTGG + Intergenic
1083797111 11:65023291-65023313 AGAGAAAGAAAAGTGGGCCCAGG + Intronic
1084799784 11:71535581-71535603 AGAGAAAGAAAAGTGGGCCCAGG - Intronic
1086077447 11:82869549-82869571 AGTGAATGAAAAACATCCACTGG + Intronic
1086177976 11:83915152-83915174 AGGGACTGAAAAGTTTCCACTGG + Intronic
1086683811 11:89707146-89707168 ACTGAATGAAGAGTAGCCATGGG + Intergenic
1086783328 11:90934340-90934362 ATTGAAAGAAATGTGGACACTGG - Intergenic
1086842007 11:91697945-91697967 AATGAATGACAAATGGCTACAGG - Intergenic
1086889383 11:92238949-92238971 AATGAATGAAAAGTTGCAAATGG - Intergenic
1087506189 11:99025048-99025070 AATAAATAAAAAGTGGCCATTGG - Intronic
1089318046 11:117605502-117605524 AGTAAATGAAAGTTGGCCAAAGG - Intronic
1090374445 11:126279019-126279041 AGTGAATGCAAGGTGGCTAAGGG + Intergenic
1091335609 11:134763294-134763316 AGTGAATGAACAGTGCGAACCGG - Intergenic
1092059632 12:5537867-5537889 AGAGAAAGAAAAGTGGGCCCAGG - Intronic
1092455161 12:8636495-8636517 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1093045488 12:14439293-14439315 AATGAAGGAAAAGTGGCCCATGG + Intronic
1093213264 12:16332785-16332807 AGGGAATAAAAGCTGGCCACTGG - Intergenic
1093380290 12:18483120-18483142 AGTGGCTGAAAAGGGGCCAATGG - Intronic
1094313763 12:29115076-29115098 AGGGAATAAAAGCTGGCCACTGG - Intergenic
1094343258 12:29436942-29436964 AGGGAATAAAAGCTGGCCACCGG - Intronic
1095449346 12:42313514-42313536 TGTGAATGAAAAGTTCCCATTGG - Intronic
1095456201 12:42388596-42388618 AGAGAAAGAAAAGTGGGCCCAGG - Intronic
1095972910 12:47916511-47916533 TGTTTATGAAAATTGGCCACAGG + Intronic
1097350464 12:58543255-58543277 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1098654302 12:73008816-73008838 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1098858447 12:75680701-75680723 ACTTAATGAAAAGTTGTCACAGG + Intergenic
1100334721 12:93618542-93618564 GGAGAATGAAAAGAGGCCAGTGG - Intergenic
1102495396 12:113315823-113315845 AGAGACTGAGAAGTGGCGACAGG - Intronic
1105209935 13:18251805-18251827 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1105688659 13:22813741-22813763 AGAGAAAGAAAAGTGGACCCGGG + Intergenic
1105879590 13:24592416-24592438 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1105920250 13:24956638-24956660 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1106046118 13:26143820-26143842 AGTGAATGAAGTGTGGCAATGGG - Intronic
1106064392 13:26330540-26330562 GGTGAATGAAAAGTGGTTAAAGG - Intronic
1106656087 13:31748005-31748027 AGTGAAGGAGAACTGTCCACTGG + Intronic
1107132902 13:36915271-36915293 AGTGATAGAAAACTGGCAACTGG + Intronic
1107777396 13:43860846-43860868 AGTGAATTAGAGGTGGCCATTGG - Intronic
1109239222 13:59863026-59863048 AATGAATGAAAAGAGGTTACGGG + Intronic
1109419753 13:62096086-62096108 AGGGAATAAAAGGTGGCCACCGG - Intergenic
1109850622 13:68058342-68058364 ACTGAAATAAAAGTGTCCACTGG + Intergenic
1110875855 13:80509631-80509653 ATTGAATGAAAATTGGCATCAGG + Intergenic
1111201828 13:84948390-84948412 GGTGACTAAAAAGTGGCCACTGG + Intergenic
1111653952 13:91129667-91129689 AAAGTATGATAAGTGGCCACGGG - Intergenic
1112007796 13:95268889-95268911 AGAGAAAGAAAAGTGGGCCCAGG - Intronic
1114006616 14:18320360-18320382 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1114604023 14:23981585-23981607 AGAGAAAGAAAAGTGGGCCCAGG + Intronic
1114609041 14:24024384-24024406 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1114802461 14:25792858-25792880 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1115908367 14:38227083-38227105 AGTGGTTGAAGTGTGGCCACTGG - Intergenic
1116533664 14:46005079-46005101 TGTGAATGAAATGTGGCCCTTGG + Intergenic
1117270915 14:54142495-54142517 AGTGAATTTAGAGGGGCCACTGG + Intergenic
1117464130 14:55975451-55975473 AATGACTGAAAATAGGCCACTGG + Intergenic
1117598443 14:57348133-57348155 AGTGAATGAAAAGTACACACTGG + Intergenic
1119163762 14:72475278-72475300 AGTGAAACACAAGTGACCACTGG - Intronic
1119823074 14:77635369-77635391 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1120138736 14:80902402-80902424 AGTCAAGGAAAAGTTTCCACAGG + Intronic
1120512021 14:85426714-85426736 AGTGGCTGAGAAATGGCCACAGG - Intergenic
1120560877 14:85990731-85990753 AGTTAATGAAATGTGGGCAGGGG + Intergenic
1120829129 14:88982573-88982595 GTTGAATGAGAAGTGCCCACAGG + Intergenic
1121149921 14:91623222-91623244 AAGGAATGAAAATTGGCCAGTGG - Intronic
1121506683 14:94483097-94483119 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1121980574 14:98450560-98450582 AGTGCAGGAAATCTGGCCACTGG - Intergenic
1123390547 15:19866996-19867018 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1123903836 15:24902919-24902941 AGGGAATAAAAGCTGGCCACCGG - Intronic
1124026683 15:25973266-25973288 AGGGAATAAAAGCTGGCCACCGG + Intergenic
1124665911 15:31592558-31592580 AGTTAATGTAAAATGGCCTCAGG - Intronic
1125264595 15:37864562-37864584 AGGGAATGAAAGCTGGCCACAGG + Intergenic
1125588797 15:40841918-40841940 AGTGAACGAAGAGTGGTGACAGG - Intergenic
1125825919 15:42676246-42676268 GGAGAGAGAAAAGTGGCCACAGG - Intronic
1128039834 15:64562140-64562162 AGAGAATGAAAAGTGGACCCTGG - Intronic
1131064999 15:89429043-89429065 GGTAAATGAAAAGTGACCAATGG - Intergenic
1131493805 15:92885035-92885057 AGTGAAGTTAAAATGGCCACTGG - Intronic
1131700428 15:94929646-94929668 AGAGAATTAAAAGGGGCCAGGGG - Intergenic
1133324254 16:4933924-4933946 TGTGAATGATAAGCGGCCGCAGG - Intronic
1134190202 16:12115124-12115146 AGTGGATGAAAAATTGCCCCTGG + Intronic
1135091736 16:19523062-19523084 AGGGAGTGAAAAGGGGCCCCTGG + Intergenic
1135289337 16:21221880-21221902 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1135780919 16:25299888-25299910 AATGAATCAAAAGTGGCCATAGG - Intergenic
1137758259 16:50919616-50919638 GTTGAATGAAGAGTGGCCAATGG + Intergenic
1138134182 16:54507495-54507517 AGAGGATGAAAGGTGCCCACTGG - Intergenic
1139142232 16:64280470-64280492 AGGGAAGAAAACGTGGCCACAGG - Intergenic
1139439075 16:66955468-66955490 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1139474132 16:67194161-67194183 AGTGAAAGATCACTGGCCACAGG - Intronic
1140546495 16:75815097-75815119 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1141389042 16:83649141-83649163 AGTGAGGTTAAAGTGGCCACAGG + Intronic
1141538281 16:84699073-84699095 AGTCAATAAAAATTGGCTACTGG - Intergenic
1142953684 17:3505552-3505574 AGCAAATGAAAAGTGGCAGCTGG + Intronic
1143421299 17:6794826-6794848 AGTCAATGGCAAGTGGCCACTGG - Intronic
1143616989 17:8057782-8057804 AATGAATGAATTGTGGCCTCAGG + Intergenic
1146310159 17:31762404-31762426 AGGGAATAAAAGCTGGCCACCGG + Intergenic
1146448577 17:32953346-32953368 AGTAGATGAAGTGTGGCCACTGG + Intergenic
1146615442 17:34353526-34353548 AGTGGGTGAAAAGAGACCACAGG + Intergenic
1146773963 17:35595780-35595802 ACTGAATGACAAGTGGCTAATGG - Intronic
1151010569 17:70489783-70489805 AGTGAAAGAAAAATGAACACTGG - Intergenic
1151163031 17:72181832-72181854 AGTGAATTAAAAGCAGCCACAGG - Intergenic
1152658887 17:81533303-81533325 AGTAACAGAAAACTGGCCACAGG + Intronic
1155547116 18:26927375-26927397 AGAGAAAGAAAAGTGGGCCCAGG + Intronic
1155602912 18:27569693-27569715 AGGGAATAAAAGCTGGCCACCGG - Intergenic
1155942290 18:31811368-31811390 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1157616910 18:48992446-48992468 AGGGCCTGAAAAGCGGCCACTGG - Intergenic
1157782990 18:50456785-50456807 AGTTTATGAAAGGTGGTCACTGG - Intergenic
1163898881 19:20083189-20083211 AGAGAAAGAAAAGTGGGCCCAGG - Intronic
1163920783 19:20286592-20286614 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1164208685 19:23078651-23078673 AGAGAAAGAAAAGTGGGCCCAGG - Intronic
1164390483 19:27815437-27815459 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1165295191 19:34921031-34921053 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1165607118 19:37115290-37115312 AGAGAAAGAAAAGTGGGCCCAGG + Intronic
1165633531 19:37321567-37321589 AGAGAAAGAAAAGTGGGCCCAGG - Intronic
1165884526 19:39068367-39068389 AGGGAATAAAAGCTGGCCACTGG - Intergenic
1166619219 19:44280689-44280711 AGAGAAAGAAAAGTGGGCCCAGG + Intronic
1166943592 19:46383758-46383780 TCTGAAAGAAAAGAGGCCACCGG - Exonic
1167814702 19:51869581-51869603 AGAGAAAGAACAGTGGCCCCAGG - Intronic
1167831558 19:52027061-52027083 AGAGAAAGAAAAGTGGGCCCAGG - Intronic
1167867322 19:52338872-52338894 AGAGAAAGAAAAGTGGGCCCAGG + Intronic
1168461109 19:56559424-56559446 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1168614180 19:57824480-57824502 AGAGAAAGAAAAGTGGGCCCAGG - Intronic
1168638373 19:58013639-58013661 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
925490631 2:4389167-4389189 AGAGAATGAAATGTGAACACAGG - Intergenic
925811379 2:7704129-7704151 AGTGAATAAAAAGAGGAGACAGG - Intergenic
925822374 2:7812963-7812985 AGTGATTGAAATATGGCAACTGG + Intergenic
926083303 2:10005994-10006016 AGGGAATGAAAGCAGGCCACCGG - Intergenic
926643608 2:15264453-15264475 AGAGATTGAAAATTGGCCAAAGG - Intronic
927097098 2:19755680-19755702 AATGAATAGAAACTGGCCACTGG + Intergenic
927422538 2:22948362-22948384 ACTGAATGAACAATGGCCAGAGG - Intergenic
928434733 2:31247549-31247571 AAGGAAAGAAATGTGGCCACAGG + Intronic
928849537 2:35728233-35728255 AGTGAAAGAATAGAAGCCACAGG - Intergenic
929004827 2:37384403-37384425 AGTGCAAGAAATCTGGCCACTGG - Intergenic
930498079 2:52174505-52174527 AGTGGTTGAAGTGTGGCCACTGG - Intergenic
930998620 2:57753970-57753992 AGTGAATTTCAAGTGGCCAGAGG + Intergenic
933036407 2:77404814-77404836 AGCTAATTAAAAATGGCCACAGG + Intronic
933067444 2:77815667-77815689 AGGGAATAAAAGCTGGCCACTGG - Intergenic
933232242 2:79822351-79822373 AGTGAATAAAAATTGTCCACTGG - Intronic
933459342 2:82561279-82561301 ATTGATTGAAAATAGGCCACTGG + Intergenic
934484721 2:94694844-94694866 AGTGTAAGAAAAGTGGGCAGAGG - Intergenic
934676245 2:96251800-96251822 AGTGAATAAAAAGTGGGTTCCGG + Exonic
935040645 2:99423412-99423434 TGTGAATGGAAAGCAGCCACGGG - Intronic
935180518 2:100685723-100685745 AGAGAAAGAAAAGTGGACCCAGG - Intergenic
935375102 2:102387642-102387664 AGTGAATGAGTAGTGACAACTGG - Intronic
936292050 2:111233690-111233712 AGTGGAAGAAAAGAAGCCACTGG - Intergenic
937970107 2:127542667-127542689 AGAGAAAGAAAAGTGGGCCCAGG + Intronic
938529946 2:132175114-132175136 AGAGAAAGAAAAGTGGGCCCAGG + Intronic
938887536 2:135667689-135667711 AGAGAATGAAAAGTATCAACAGG - Intronic
940358269 2:152769169-152769191 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
941443103 2:165563325-165563347 AGTGATTGAAGTATGGCCACTGG - Intronic
941859408 2:170263396-170263418 AGAGAAAGAAAAGTGGGCCCAGG + Intronic
943142680 2:184002417-184002439 AGTGAATGCACAGTGTCCATAGG - Intergenic
943327615 2:186520944-186520966 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
943327792 2:186522348-186522370 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
945001014 2:205350723-205350745 AGTGAAAGAAAAGAGGTCTCTGG + Intronic
948009301 2:234637823-234637845 AGTGGCTCAGAAGTGGCCACTGG - Intergenic
948718159 2:239879469-239879491 AGTCTATGAAGTGTGGCCACTGG - Intergenic
1168884182 20:1233889-1233911 AGGGACTGAAAATTGACCACTGG + Intronic
1169432292 20:5548549-5548571 AGAGAATGAAAAATGACCTCTGG + Intronic
1169510962 20:6263075-6263097 AGAGATTGAACAGTGGCCTCAGG + Intergenic
1170397788 20:15946757-15946779 AGAGAAAGAAAAGTGGGCCCAGG + Intronic
1170613327 20:17930962-17930984 AATAAAGAAAAAGTGGCCACAGG - Intergenic
1171256751 20:23694450-23694472 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1171264107 20:23756372-23756394 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1173292611 20:41727786-41727808 AGGGAATAAAAGCTGGCCACAGG - Intergenic
1173373189 20:42458556-42458578 AGTGAATGCAATGGGGCCAGGGG - Intronic
1174708323 20:52679367-52679389 AGTGAATGACAAGTGGGGCCTGG + Intergenic
1177738441 21:25122112-25122134 AGTGGTTGAAGAATGGCCACTGG + Intergenic
1178687101 21:34720615-34720637 TGTGAAGGGAAATTGGCCACAGG - Intergenic
1178705389 21:34868616-34868638 AGTGAATGACAAGTGGTCCAGGG + Intronic
1179347928 21:40578552-40578574 AGAGAATAAAAGCTGGCCACTGG + Intronic
1179585380 21:42371003-42371025 AGGGAATGAGCAGTGGCCACAGG - Intergenic
1180431125 22:15251171-15251193 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1180513684 22:16119072-16119094 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1180766325 22:18347598-18347620 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1180779990 22:18514780-18514802 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1180812704 22:18772101-18772123 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1181198862 22:21206349-21206371 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1181400873 22:22649440-22649462 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1181534953 22:23536916-23536938 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1181702855 22:24630538-24630560 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1183549398 22:38472489-38472511 AATAAATAAAAAGTGGCCAAAGG + Intronic
1183665746 22:39244866-39244888 AGGGAATGAAAAATGGGCGCTGG + Intergenic
1184463911 22:44658113-44658135 AGTGAATGATGAGAGGCTACAGG + Intergenic
1184951167 22:47843566-47843588 AGAGAATTAAAAGAGGACACTGG - Intergenic
1203227943 22_KI270731v1_random:88488-88510 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
949741321 3:7237762-7237784 AGGGAATAAAAGCTGGCCACTGG - Intronic
950387985 3:12674968-12674990 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
950629605 3:14273697-14273719 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
953126768 3:40097897-40097919 AGAGAATGAAGTGTTGCCACAGG + Intronic
954588856 3:51762760-51762782 AGTGTATGCAAAGTGGCACCAGG + Intergenic
954749185 3:52804126-52804148 TCTGAAGGAAAACTGGCCACGGG + Intronic
954868212 3:53747572-53747594 AGTGACTGAGAAGTGGCCCAAGG - Intronic
956801613 3:72764821-72764843 AGTGAATGAAAAGTGTCAGCTGG - Intronic
957141880 3:76370188-76370210 AGGGAATGCAAAGTTTCCACTGG - Intronic
958840599 3:99200042-99200064 AGGAACTGAAAAGTGTCCACCGG - Intergenic
958858800 3:99420172-99420194 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
960245366 3:115394254-115394276 AGTGGACTAAAAGTAGCCACAGG - Intergenic
961912117 3:130328654-130328676 AGCCAATGAATAGTGGCCAGGGG + Intergenic
962484734 3:135831278-135831300 AGAGAATGTAAAGTGGGCAGTGG - Intergenic
963468134 3:145709341-145709363 AGAGAAAGAAAAGTGGGCCCGGG + Intergenic
964327446 3:155562703-155562725 AGTGAGTGGAGATTGGCCACAGG - Intronic
965922416 3:173933463-173933485 AGTGTAAGAAAAATGGCCAGAGG + Intronic
967086764 3:186102311-186102333 AGTGTATTACCAGTGGCCACTGG + Intronic
968373785 4:19912-19934 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
968392969 4:207892-207914 AGAGAAAGAAAAGTGGGCTCAGG + Intergenic
968942280 4:3645039-3645061 AGTGAATGAATGGTGGGCGCTGG + Intergenic
970418150 4:15879439-15879461 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
971026874 4:22597853-22597875 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
973044612 4:45520075-45520097 AGAGAATAAAAGCTGGCCACCGG - Intergenic
973298013 4:48548337-48548359 AGTGAATGAAAAGTTGAGATAGG - Intronic
973712429 4:53642969-53642991 AGTCAATGTTAAGTGGCCTCTGG - Intronic
974480136 4:62432151-62432173 AGGGAATAAAAGCTGGCCACCGG + Intergenic
974674353 4:65071335-65071357 TGGGAATGAATTGTGGCCACAGG - Intergenic
974952423 4:68598910-68598932 AGAGAAAGAAAAGTGGGCCCAGG - Intronic
974960576 4:68694319-68694341 AGAGAAAGAAAAGTGGGCCCTGG - Intergenic
975258366 4:72267124-72267146 AGTGAATGGATATTGGGCACAGG + Intergenic
975818140 4:78241082-78241104 AGTGAATGGAAAGTGGGGAAAGG + Intronic
977400385 4:96524198-96524220 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
978983946 4:114985349-114985371 AATGAATGAAGAGTGGCAAAAGG - Intronic
979006057 4:115298662-115298684 AGTGCAGGAAATGTGGCCACTGG - Intergenic
980109357 4:128620567-128620589 AGGGAATAAAAGCTGGCCACCGG + Intergenic
980760231 4:137223146-137223168 AGGGAATAAAAGCTGGCCACTGG + Intergenic
982441349 4:155440035-155440057 AGGGAATAAAAGCTGGCCACAGG + Intergenic
982823717 4:159976580-159976602 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
984107976 4:175574327-175574349 AAAGAATAACAAGTGGCCACAGG - Intergenic
985057872 4:186050893-186050915 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
985623385 5:968434-968456 AGAGAATGAAAAGCTTCCACTGG + Intergenic
985734102 5:1567483-1567505 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
986564960 5:9103346-9103368 AGCAAATGAAACGTGGCCATTGG - Intronic
986817551 5:11429255-11429277 AGTGAATGAAATATGGCAATGGG - Intronic
986920665 5:12675623-12675645 AAAGATTGAAAAGTGGCCAAAGG + Intergenic
986976745 5:13403389-13403411 AGTGAATGAGAAGAGGGCACAGG + Intergenic
987978717 5:25051022-25051044 AGTGAATGAGAAATGTCCTCAGG + Intergenic
988095700 5:26606497-26606519 AGAGAATGGAAAGGGGCAACAGG + Intergenic
988199104 5:28047913-28047935 AGTGACGGAAATCTGGCCACTGG + Intergenic
989830263 5:45908111-45908133 AGTGGATCAAAAGTTGCCAAAGG + Intergenic
991216529 5:64162438-64162460 AGAGAATGAGAAAAGGCCACTGG - Intergenic
991332758 5:65510476-65510498 AATGAATGAAAAATGGCGTCCGG + Intergenic
991717657 5:69466750-69466772 AGGGAATAAAAGCTGGCCACCGG + Intergenic
992595428 5:78342285-78342307 TGTGAATGAAAATTAGCCAAAGG + Intergenic
993889490 5:93456676-93456698 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
993889673 5:93458148-93458170 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
994053054 5:95383597-95383619 AGTGCATGGAAACTGGCCTCTGG + Intergenic
994149379 5:96431357-96431379 GGTGAATGAAAACTGCCCAAAGG - Intronic
995750537 5:115449266-115449288 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
996780627 5:127182897-127182919 AGGGAATAAAAGCTGGCCACGGG + Intergenic
997465261 5:134083835-134083857 AGTGAGGGAAGAGTGGCCACGGG + Intergenic
997615942 5:135246298-135246320 AGAGAAAGAAAAGTTGCCATGGG + Intronic
998327908 5:141298330-141298352 AAAGAAAGAAAAGTGCCCACCGG + Intergenic
998915576 5:147007515-147007537 AGGGAATAAAAGCTGGCCACCGG + Intronic
999361574 5:150990571-150990593 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
999916930 5:156273006-156273028 AGTGAATGAAAAATTGCCTGAGG + Intronic
1002377530 5:178798927-178798949 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1002721963 5:181266953-181266975 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1003363556 6:5451516-5451538 AGTGATTAAAAAGTCTCCACTGG - Intronic
1004302205 6:14468889-14468911 TGTGACTGAGAAGTGGTCACTGG - Intergenic
1004961259 6:20791233-20791255 TGAGAATGAAAAGAGGTCACAGG + Intronic
1005534922 6:26745526-26745548 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1005560497 6:27035414-27035436 AGTGACTGAAAGGTGGTCACTGG - Intergenic
1005652194 6:27894686-27894708 AGTGTATGGAAAATGGACACCGG - Intergenic
1005729503 6:28683296-28683318 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1005730074 6:28688241-28688263 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1005730521 6:28692843-28692865 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1006026120 6:31148297-31148319 AGGGGCTGGAAAGTGGCCACTGG - Intronic
1006238498 6:32657218-32657240 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1006443137 6:34064439-34064461 ACTGGATGAAAGGTGGCCGCTGG - Intronic
1006830441 6:36964828-36964850 AGAGAAGGAATAGTTGCCACAGG - Exonic
1009885271 6:69617434-69617456 GGGGAATGCAAAATGGCCACTGG - Intergenic
1009947109 6:70352802-70352824 AGCAAATGACAAGTGGCCCCAGG + Intergenic
1011407005 6:87026198-87026220 AGGGAATGAAAAGTGGCCTGTGG + Intergenic
1012052904 6:94365505-94365527 AGGAACAGAAAAGTGGCCACTGG - Intergenic
1012136231 6:95560715-95560737 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1012370594 6:98501653-98501675 AATGAGTGAAAAATAGCCACTGG - Intergenic
1015032433 6:128611504-128611526 AGTGAATGAAACATTCCCACTGG - Intergenic
1016677423 6:146787758-146787780 ATTGAATGAAAGGTGGCAATAGG - Intronic
1018658800 6:166066257-166066279 ATAGAATGAAAAGTGGGAACAGG + Intergenic
1019533101 7:1513410-1513432 TCTGAATGACAAGTGGCCACAGG + Intergenic
1021100400 7:16582392-16582414 ACAGAATGATAAGTGCCCACAGG - Intergenic
1021676387 7:23084616-23084638 ACTGTAAGAAAACTGGCCACTGG - Intergenic
1021756126 7:23854914-23854936 AGGGAATAAAAGCTGGCCACCGG - Intergenic
1023981937 7:45075462-45075484 AGAGAATGAGAGGAGGCCACAGG + Intronic
1024971473 7:55075296-55075318 AGTGAATGAAAAGTGGCCACCGG - Intronic
1026008590 7:66619048-66619070 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1026076933 7:67180338-67180360 AGTGAGTTAAATGTGGACACGGG - Intronic
1026830977 7:73609975-73609997 AGTCAGTGAAAAGTGGTCAGGGG - Intronic
1027654930 7:80919049-80919071 AGTGAATGGAAAGTGGCCGGAGG + Exonic
1028287935 7:89027142-89027164 ACTGACTGAAAAGTATCCACTGG + Intronic
1028980149 7:96958878-96958900 GGAGACTGAAAACTGGCCACTGG + Intergenic
1030124255 7:106139553-106139575 AATGCATGAAAAGTGGGCCCTGG - Intergenic
1031075939 7:117212358-117212380 AGTGAAGGAAAAGTGACCTTGGG - Intronic
1033482027 7:141751988-141752010 AGAGAAAGAAAAGTGGGCCCAGG - Intronic
1034161441 7:148996767-148996789 AGTGATTAAAAAGTGGCCACTGG + Intergenic
1037345482 8:17896236-17896258 AGTGAATAAATAGGGACCACAGG - Exonic
1038055747 8:23856100-23856122 AGTAGATGAGAAATGGCCACTGG + Intergenic
1038600625 8:28938747-28938769 AGTGAATGAAAAGATACCCCTGG - Intronic
1039291582 8:36101016-36101038 AATGAATGAAAAATGTCAACAGG + Intergenic
1039498997 8:38002114-38002136 AGTGCTGGAAATGTGGCCACTGG - Intergenic
1039674808 8:39650887-39650909 AGAGAAAGAAAAGTGGACCCAGG + Intronic
1039731849 8:40288133-40288155 AGTGAATGCAAAGTGGCATCAGG - Intergenic
1039915363 8:41856572-41856594 AATGCATGAAAAGTGACTACAGG + Intronic
1040632480 8:49231309-49231331 AGTGGATGGAAATTGGCGACAGG + Intergenic
1041917528 8:63151734-63151756 AGTGCAGGAAATTTGGCCACTGG - Intergenic
1044017499 8:87062046-87062068 AGTGAATGAAAAGTGAACTGAGG + Intronic
1045207595 8:100057858-100057880 AATGAATGAAATATGGCAACAGG + Intronic
1046035185 8:108832272-108832294 AGTGGCTGAAGTGTGGCCACTGG - Intergenic
1047872853 8:129104158-129104180 AGTTAGAGAAAAGTGGCCGCAGG - Intergenic
1050189568 9:3010506-3010528 AGAGACTGAAAAGTGGTCACAGG + Intergenic
1050385164 9:5082128-5082150 AGAGAAAGAAAAGTGGGCCCAGG + Intronic
1052432669 9:28387441-28387463 AGTGAATAAAAGCTGGCCACTGG + Intronic
1053277407 9:36793960-36793982 AATGAATGAAAAGTGGCTGTAGG - Intergenic
1053536158 9:38928279-38928301 AGTGAGAGAAAAGTTGCAACTGG + Intergenic
1054629977 9:67435673-67435695 AGTGAGAGAAAAGTTGCAACTGG - Intergenic
1055636528 9:78284220-78284242 AGAGAATAAAAGCTGGCCACTGG - Intergenic
1057685777 9:97232993-97233015 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1058480705 9:105391656-105391678 AATGAATGAAAAGAGGCAGCAGG - Exonic
1059042215 9:110827102-110827124 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1059082359 9:111264093-111264115 AAAGACTGAAAAGTGGCCATTGG - Intergenic
1059203065 9:112436484-112436506 AATGAATGAAAAAGGGCCAATGG + Intronic
1059777885 9:117494047-117494069 AGTCAATGCAAAGTGCCCAGTGG - Intergenic
1060054102 9:120398974-120398996 AGTGACAGAAAAGTGGCTAGAGG + Intronic
1060102691 9:120854816-120854838 ATGGAATGAAAAGTGGCACCAGG - Intergenic
1060577639 9:124711700-124711722 ATTCAAAGAAAAGTGACCACTGG + Intronic
1061121857 9:128648106-128648128 ACTGAATGAAAACTGAACACTGG + Intronic
1061752181 9:132786660-132786682 AGTGCATGGAAAGAGCCCACAGG - Intronic
1061829789 9:133284278-133284300 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1203377731 Un_KI270442v1:390459-390481 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1187385710 X:18846582-18846604 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1190125759 X:47703991-47704013 GTTAAATGAAAAGGGGCCACAGG + Intergenic
1193393258 X:80954680-80954702 AGTGATTGAAGTATGGCCACTGG + Intergenic
1194066625 X:89269495-89269517 AGGGAATAAAAACTGGCCACCGG - Intergenic
1194385105 X:93242976-93242998 AAGGAAAGAAAAGTGCCCACCGG - Intergenic
1196868022 X:120086902-120086924 AGTGCAGGAAAATGGGCCACTGG - Intergenic
1197268703 X:124403218-124403240 ACTGATTGAAAAGTGAGCACTGG + Intronic
1198013055 X:132579199-132579221 ACTGAAGAAAAAGTGGCCTCAGG - Intergenic
1198268266 X:135031198-135031220 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic
1198778517 X:140207874-140207896 ATTGAATAAAAAGTGGGCAGTGG + Intergenic
1199654461 X:149980927-149980949 AGTGACTGAGGGGTGGCCACAGG - Intergenic
1199686261 X:150268266-150268288 AGTGCAGGAAAAGTGATCACAGG - Intergenic
1200720797 Y:6603649-6603671 AGGGAATAAAAGCTGGCCACCGG - Intergenic
1201234249 Y:11894569-11894591 AGTGACAGAAATCTGGCCACTGG - Intergenic
1201400804 Y:13602049-13602071 AAGAAAAGAAAAGTGGCCACTGG - Intergenic
1202064202 Y:20920732-20920754 AGTGGGTGAAAAGTGGGCAAAGG - Intergenic
1202342068 Y:23880459-23880481 AGAGAAAGAAAAGTGGGCCCAGG + Intergenic
1202528701 Y:25789626-25789648 AGAGAAAGAAAAGTGGGCCCAGG - Intergenic