ID: 1024973125

View in Genome Browser
Species Human (GRCh38)
Location 7:55088637-55088659
Sequence TGGCTTTCCCTGTGATTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024973120_1024973125 6 Left 1024973120 7:55088608-55088630 CCTCTGGGCATGCGACCTTTCCC 0: 1
1: 0
2: 0
3: 11
4: 118
Right 1024973125 7:55088637-55088659 TGGCTTTCCCTGTGATTATCAGG 0: 1
1: 0
2: 1
3: 16
4: 195
1024973122_1024973125 -9 Left 1024973122 7:55088623-55088645 CCTTTCCCGTCATTTGGCTTTCC 0: 1
1: 0
2: 0
3: 11
4: 184
Right 1024973125 7:55088637-55088659 TGGCTTTCCCTGTGATTATCAGG 0: 1
1: 0
2: 1
3: 16
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024973125 Original CRISPR TGGCTTTCCCTGTGATTATC AGG Intronic
900965102 1:5952288-5952310 TGGGTTTCCCTATGCTCATCTGG + Intronic
905078559 1:35296262-35296284 TAGATTTCCCTGGCATTATCTGG - Intronic
906683859 1:47750051-47750073 TAGCTTTCCTTGTCACTATCAGG + Intergenic
907763302 1:57383315-57383337 TGTCTGTCCCTCTGATTCTCAGG + Intronic
908456404 1:64308847-64308869 TTTCTTTCACTGTGATTTTCTGG + Intergenic
910103905 1:83609787-83609809 TGCCATTCCCTGAAATTATCAGG + Intergenic
910441294 1:87254981-87255003 TGGATTTTCCTGAGATTATCAGG + Intergenic
910779763 1:90917474-90917496 TGGCTTTCCTTGTGTTTATTTGG - Intronic
911059490 1:93735308-93735330 TGATTTTCCATGTGATTCTCTGG + Intronic
911346127 1:96698761-96698783 TGGTTTTCTTTGTGTTTATCAGG + Intergenic
912325735 1:108759866-108759888 TGGCTTTCACAGTTATTATGAGG - Intronic
915607032 1:156958870-156958892 TTTCTTTCCCTGTGTTTATCTGG - Intronic
917716334 1:177741507-177741529 TGGCTTTACCTCTGATTCTTAGG - Intergenic
917925822 1:179788403-179788425 AGGCTTTCCCTGTGAGCTTCAGG - Intronic
920158329 1:203974909-203974931 TGGCTATAGCTGTGATTATTGGG - Intergenic
920420517 1:205830174-205830196 TGGCTTTCCCCCTGATTCTGTGG + Intronic
921673114 1:217948344-217948366 TTCCTTTCCCTGTGCTCATCAGG + Intergenic
922370271 1:224903464-224903486 TATCTTTCCCTATCATTATCTGG + Intronic
922728801 1:227939524-227939546 TGGCTGTCCCTGTGTGTTTCAGG - Intronic
923021993 1:230172227-230172249 TGGCTTCCCCAGTGAATATGAGG - Intronic
923548673 1:234943787-234943809 TGGCATTCCCTTTGAATAGCTGG - Intergenic
1062864754 10:842740-842762 TGGCATTCCCAGGGACTATCAGG + Intronic
1064064077 10:12165788-12165810 TGCCTTGCCCTGCGATTATTTGG - Exonic
1067209120 10:44243673-44243695 TCTCTTTCCCAGTGATTGTCAGG - Intergenic
1069061199 10:63896290-63896312 GGGCTTACCTTGTGATTATGAGG - Intergenic
1073320637 10:102614215-102614237 TGTCTTTCCCTGTGATCAGCAGG - Intronic
1074558818 10:114516759-114516781 AGCCTTTCCCTGTGATTAACTGG - Intronic
1074562274 10:114545010-114545032 GGACTTTCCCTGTGATAAACTGG + Exonic
1074706594 10:116138420-116138442 TGGCTTTCTATTTGATTTTCAGG + Intronic
1075431297 10:122384269-122384291 TGGCTTTGACTTTGCTTATCAGG + Intronic
1076613676 10:131742823-131742845 TGGCTTTCCCTGTGAGGACACGG + Intergenic
1078566794 11:12421778-12421800 TGGCTTTTCCTTTTATTATGTGG - Intronic
1078633151 11:13023665-13023687 TGGTTTTCACTGTGATTATGGGG + Intergenic
1079175913 11:18140453-18140475 TGGATGACCCTGTGATTTTCAGG - Exonic
1079263570 11:18908117-18908139 TGGATGACCCTGTGATTATCAGG + Intergenic
1079436919 11:20464516-20464538 TGGATGTCCTTGTGATTTTCAGG - Exonic
1079780202 11:24592819-24592841 TGCCTATCCCTGTGATTATTTGG - Intronic
1079881326 11:25931101-25931123 TGGCAATTCCTGAGATTATCAGG + Intergenic
1081305168 11:41502846-41502868 TGGCATTACCTGTCATTACCTGG + Intergenic
1083169914 11:60917335-60917357 TGGCTTAGCCTCTGATCATCAGG + Intronic
1086399932 11:86452345-86452367 TCACTGTCCCTTTGATTATCAGG - Intronic
1088226251 11:107623384-107623406 TGGCTTTCCCTCAGCTTTTCAGG + Intronic
1088668339 11:112117257-112117279 TGCCTTCCACTGTGATTATGAGG - Intronic
1094040842 12:26120861-26120883 AAGCTTTCTTTGTGATTATCTGG + Exonic
1094485015 12:30918150-30918172 TGCCCTTCCCAGTGATTATGGGG - Intergenic
1098584619 12:72141388-72141410 AGTCTTTCTCTGTGGTTATCGGG - Intronic
1099301017 12:80894312-80894334 TTGCTTTCCTTGTGCTTACCTGG - Intronic
1099408530 12:82294086-82294108 TGGGTTCCCATGTAATTATCTGG + Intronic
1103009011 12:117443456-117443478 TGGCTATCACTGTGATTAACAGG - Intronic
1103936279 12:124478943-124478965 TGGCTTTCCCTCTTCTTGTCAGG - Intronic
1106306843 13:28519680-28519702 TAGCTTTCACTCTGCTTATCTGG - Intergenic
1107953583 13:45486772-45486794 TAGCTTTTCCTGTGATGCTCAGG + Intronic
1109051625 13:57490075-57490097 TGGCTTTCACAGAGATTATCTGG + Intergenic
1109385178 13:61620357-61620379 TTGTTTTCACTGTCATTATCAGG + Intergenic
1111385745 13:87525173-87525195 TGGCTTTCACTGGGATTGGCTGG - Intergenic
1113053839 13:106245437-106245459 GGGCTTTCCCAGTGATTTTAAGG - Intergenic
1117658384 14:57979787-57979809 TGGCTTTCCCTGTGAGTTGCTGG + Intronic
1118835508 14:69475173-69475195 TGGCTTTCCCTTAGATGTTCTGG + Intergenic
1119161731 14:72458488-72458510 TGGCTTTCCCAGTGCTGATGAGG - Intronic
1120832690 14:89012165-89012187 TGTGTTTCCATGGGATTATCAGG - Intergenic
1121180151 14:91922826-91922848 TGGCTCTCACTGTGATGATAGGG - Intronic
1121295538 14:92818638-92818660 AGGATTGCACTGTGATTATCTGG + Intronic
1125613494 15:40989215-40989237 TGGCTTTCCCTAGAATTCTCAGG + Intronic
1126239233 15:46422159-46422181 TGGATTTTGCTGTGTTTATCTGG - Intergenic
1127554992 15:60079056-60079078 TGGATTTCCATGTGATGATTCGG - Intergenic
1130524089 15:84688837-84688859 TGGGTTTCACTGTGTTGATCAGG - Intronic
1131328096 15:91468636-91468658 TGGCCTGCCCTGTGAATTTCAGG - Intergenic
1132133168 15:99304263-99304285 TGTCAACCCCTGTGATTATCTGG + Intronic
1132297942 15:100757332-100757354 TAGCTTTTCCAGTGATTATTTGG + Intergenic
1138042427 16:53687066-53687088 TGGCTTTTCAGGTGATCATCAGG + Intronic
1141765382 16:86054951-86054973 TTGGTTTCCCTGTGATTATTCGG - Intergenic
1145943238 17:28754964-28754986 TGGGTTTCCCCGTGTTTGTCAGG + Intergenic
1149152375 17:53583244-53583266 TATCTTTCCCTATGTTTATCGGG - Intergenic
1151953933 17:77371383-77371405 TGGCTGACCCTGTGCTAATCTGG + Intronic
1153642468 18:7168556-7168578 AAGCTTTCCCTGTGACTTTCAGG - Intergenic
1153992292 18:10411193-10411215 TTGCTTTCCCTTTGATTCGCAGG - Intergenic
1156522181 18:37731213-37731235 TGGCTTTCCCTGTGAGATACAGG + Intergenic
1157155777 18:45264574-45264596 TGCCTTTCACTGTGATTGTGAGG - Intronic
1158579623 18:58670709-58670731 TGCCTTTCCCTGGAATGATCCGG - Intergenic
1159419248 18:68195250-68195272 TGCCAGTCCCTGTGATTATAAGG + Intergenic
1159726475 18:71966690-71966712 GGGCTTTCCTTTTGATTATTAGG + Intergenic
1162955085 19:14092933-14092955 TTTCTGTCCCTCTGATTATCTGG + Exonic
1165885279 19:39073717-39073739 TGGCTGTGGCTGTGATTATGAGG + Intergenic
925459627 2:4049224-4049246 TGCCTGTCTCTGTGATTGTCAGG - Intergenic
925888359 2:8412660-8412682 TGGCTTTCTCTGTGCTAAACTGG - Intergenic
926150369 2:10422550-10422572 GGGCTTGCCCTGTGAGTTTCAGG + Intronic
928796899 2:35034059-35034081 TGGCTTTCACTGTGGGCATCAGG + Intergenic
929051993 2:37845526-37845548 TGAGTTTCCCTATGATCATCTGG + Intergenic
929533675 2:42767557-42767579 GGGCTTTCCCTGGGATCCTCAGG - Intronic
930783695 2:55249583-55249605 TGTCTTTCACTGTGAATACCTGG - Intronic
931489836 2:62733404-62733426 TGTATTTCCCTGTTATTATATGG + Intronic
931587563 2:63844751-63844773 AGGCTTTCCCTATGTTTCTCAGG + Intronic
935214567 2:100965891-100965913 TGGTTTTCTCTGAGATGATCTGG + Intronic
937080489 2:119136655-119136677 TGGCTTTCCCTGGGTCTCTCAGG - Intergenic
937252276 2:120532514-120532536 TGGCCTTCCCTGGGCTTTTCTGG - Intergenic
937633837 2:124133517-124133539 ATGCTTTCCCTCTGCTTATCTGG + Intronic
938636167 2:133228813-133228835 TGGCTTTCTCTTTTATTCTCTGG - Intronic
938901350 2:135800952-135800974 TGGCTCTCCCTCTTATTACCTGG + Intronic
939514312 2:143147568-143147590 TGAATTTCCCTCTGATGATCAGG - Intronic
943785569 2:191874663-191874685 GGGCTTTGCCTTTTATTATCTGG - Intergenic
943884279 2:193193740-193193762 TGGCTTTACCTGTGTTTTTTAGG + Intergenic
945200727 2:207278288-207278310 TGGCTTTCCCTGTGATTCCCAGG + Intergenic
946978126 2:225175797-225175819 TGCCTTGCCCTGTTTTTATCAGG - Intergenic
947516413 2:230808705-230808727 TGGCCATCCCTGTTATGATCAGG + Intronic
1169817835 20:9677007-9677029 TTGATTTCCCTGTGGTTTTCAGG - Intronic
1174033274 20:47648404-47648426 AGGCTTTCTCTGGGATTATTCGG - Intronic
1174419738 20:50391684-50391706 TGGCTTTCCCTGGGAGTGCCCGG - Intergenic
1177339898 21:19784893-19784915 TGCCTTTCACCGTGATTATGAGG - Intergenic
1177597353 21:23262520-23262542 TGGTTTTCACTGTGATTGTGGGG - Intergenic
1179101296 21:38357426-38357448 TGTCCTTCCCTGTGACTATCAGG - Intergenic
1179294495 21:40049161-40049183 AGTGTTTCCCTGTGATCATCAGG + Intronic
1181316287 22:21972850-21972872 TGGCTCTGCCTCTGATCATCAGG - Intronic
1181655700 22:24296332-24296354 TGCCTTTCCCTGTTATTTTTGGG + Intronic
1185048135 22:48539310-48539332 CGGCTTTGCCTCCGATTATCTGG - Exonic
949117009 3:338394-338416 TGGCATTTACTGTGTTTATCTGG - Intronic
950616295 3:14161728-14161750 GAGCTTTCCCTCTAATTATCAGG + Intronic
951002209 3:17575556-17575578 TCCCTTTCCTTGTGTTTATCTGG - Intronic
953324871 3:42004513-42004535 TGGCTTTCTCTGTCTTTATTGGG - Intergenic
956038272 3:65119125-65119147 TTGCTTCCCCTGAGATTAACTGG + Intergenic
956347594 3:68298157-68298179 TAGCTTGCCCTGTGTTCATCAGG - Intronic
956583164 3:70836279-70836301 TGCCTTCCCCTGTGATTGTGAGG + Intergenic
956741099 3:72276835-72276857 AGGCTTTCCCTGTCAGTGTCAGG + Intergenic
957688676 3:83538531-83538553 TGGCTTTACTTGTGATTTTGAGG - Intergenic
957723506 3:84034402-84034424 GGGCTTTACTTCTGATTATCTGG - Intergenic
958254598 3:91310985-91311007 GGGCTTTCACTGTGTTGATCAGG - Intergenic
959710334 3:109379311-109379333 AGGATTTCCCTGTTATTACCCGG - Intergenic
961387277 3:126529843-126529865 TGGCTTTCCCTGTGCTGCTCTGG + Intronic
964646067 3:158959674-158959696 TTGCTTTACCTGTCAGTATCAGG + Intergenic
965838080 3:172872967-172872989 TGGCTAGCCCTTTGATTATTTGG + Intergenic
967427325 3:189341943-189341965 TGGCTGTCCCTGGGTTGATCAGG + Intergenic
969252844 4:5981350-5981372 ATGCTTTCCCTGAGATCATCAGG + Intronic
971089560 4:23325030-23325052 TGCTTATCCCTGTGATTATTTGG + Intergenic
972963691 4:44484954-44484976 TGGCTATCGCTGTGATGACCTGG - Intergenic
973272659 4:48277517-48277539 TGGATTTCTTTGTGTTTATCCGG - Intergenic
974242020 4:59261366-59261388 TGACTTTCCCTGTGGGAATCTGG - Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
974431097 4:61797027-61797049 TGGCTTTTCCTTTGCTTCTCAGG + Intronic
974595945 4:64014620-64014642 TGGCTCCTCCTGTGACTATCTGG - Intergenic
974959989 4:68686462-68686484 TTACTTTGCCTGTGATTATGGGG - Intergenic
978383445 4:108155353-108155375 TCGCTTTCCTTGTGATTGTTAGG - Intronic
979225032 4:118275134-118275156 TGACTTTCCTACTGATTATCAGG - Intergenic
980193387 4:129555804-129555826 TGGCTTTCACTTTGCTTAACAGG + Intergenic
981663798 4:147198508-147198530 TGACTTTCCCCTTAATTATCAGG - Intergenic
981923003 4:150107565-150107587 TGGGTTTCCCTGTGTTTCCCAGG + Intronic
984316179 4:178135677-178135699 TGGCTTGCCTTCTAATTATCTGG - Intergenic
984429871 4:179635897-179635919 TGTTTTTCCCTGTTATTATATGG - Intergenic
984450998 4:179901188-179901210 AGGCTTTCCCAGAGATTATGTGG + Intergenic
986315810 5:6585595-6585617 TTGCCTTCCCTGTGAATTTCAGG - Intergenic
986922167 5:12699004-12699026 TGTATTTTCCTGTGCTTATCAGG - Intergenic
993125365 5:83828191-83828213 TGGCTATCTATGTGATTATTTGG - Intergenic
996175185 5:120347698-120347720 TGGCTTTTCCAGTGATTGCCTGG - Intergenic
998651935 5:144130581-144130603 TGGCTTTCCGTGTTAATTTCTGG + Intergenic
1000758887 5:165196216-165196238 TGGATTTCACTGTGAATATAAGG - Intergenic
1001202547 5:169731454-169731476 TGCCTTTCCCCGTGATTGTGAGG + Intronic
1001901876 5:175438061-175438083 TGTCTTTTGCTGTGGTTATCTGG - Intergenic
1003022039 6:2518254-2518276 TTGTATTCCCTGTGGTTATCAGG - Intergenic
1004900238 6:20186780-20186802 TGGCTTTTCCTCTGAATTTCTGG - Intronic
1005288862 6:24358418-24358440 GGGCTTTCCCTGTGTTTCCCAGG - Intergenic
1006104113 6:31706112-31706134 TGACTTTCCCTGTGGTTGTCTGG - Intronic
1006244640 6:32720525-32720547 TGGATTGCCCTGTGATTTTCTGG + Intergenic
1007816992 6:44531648-44531670 TGGCTCTCACTGTGGTTTTCAGG - Intergenic
1008547640 6:52597609-52597631 TGGCCTTCCCTGTCACTAGCTGG - Intergenic
1009189224 6:60609521-60609543 GGGCTTTCACTGTGTTGATCAGG + Intergenic
1010821616 6:80421573-80421595 TGGCCATCCATGTCATTATCAGG - Intergenic
1016099946 6:140086842-140086864 TGGGCTTCCCTTTGATTAACAGG + Intergenic
1016225221 6:141726749-141726771 TGGGTAACCCTGGGATTATCTGG + Intergenic
1018676515 6:166226731-166226753 TGGCTTTAGCTGGGATCATCAGG - Intergenic
1019763549 7:2832208-2832230 TGACTTTCCCAGTGATGTTCCGG + Intronic
1020921046 7:14264779-14264801 TGGCTGTGGCTGTGGTTATCTGG - Intronic
1021967564 7:25936110-25936132 TGGCTTTCTCTCTGTTTATTTGG - Intergenic
1022640697 7:32179864-32179886 TTTCTTTCCCTGTGCTTCTCAGG - Intronic
1024533459 7:50411242-50411264 TGGCTTTCCCTTTGAAGCTCTGG + Intergenic
1024876367 7:54028737-54028759 TGGGTTTGCCTGTGCATATCTGG - Intergenic
1024973125 7:55088637-55088659 TGGCTTTCCCTGTGATTATCAGG + Intronic
1029898310 7:104010374-104010396 TGGCCTGCCCTGTGATTTCCAGG + Intergenic
1030921430 7:115393602-115393624 TTGCTGTTCCTGTTATTATCTGG + Intergenic
1032009178 7:128330942-128330964 TGACTTTTCTTGTGATCATCTGG - Intronic
1032404347 7:131644869-131644891 TGGCTTTAGCTGGGATTGTCAGG - Intergenic
1033950103 7:146774059-146774081 TGGTTTTCCATTTGAATATCAGG + Intronic
1035760729 8:2066834-2066856 TGGCTGTGCCTGTGGTGATCTGG + Intronic
1037893312 8:22635659-22635681 TGGCGTTACCTGTGCTTCTCGGG + Intronic
1038840868 8:31183570-31183592 GGGGTTTGCCTGTGGTTATCTGG - Intergenic
1042385551 8:68169639-68169661 TGATTTTCCCACTGATTATCTGG - Intronic
1042912449 8:73841693-73841715 TTGTTTTCTCTGTAATTATCCGG - Intronic
1043771338 8:84205499-84205521 TGGCTTTCCCTTTGCATATGTGG - Intronic
1045289884 8:100823963-100823985 AGCCTTTTCCTGTGATTCTCTGG + Intergenic
1048488426 8:134869783-134869805 TGGCTGCCCCTGTAATTACCTGG + Intergenic
1048578089 8:135708770-135708792 TGACTTTCCCTGTGGGTACCAGG - Intergenic
1048637434 8:136312454-136312476 TGGATTTTGCTGTGATTATTTGG + Intergenic
1054195786 9:62031029-62031051 TGGCCTTCCCTGTGAAACTCAGG + Intergenic
1054642622 9:67557661-67557683 TGGCCTTCCCTGTGAAACTCAGG - Intergenic
1055118251 9:72628357-72628379 TGACTTTTCCTGTGTTCATCTGG + Intronic
1055581291 9:77709461-77709483 AGGCTCTCACAGTGATTATCAGG - Intergenic
1056005039 9:82260696-82260718 TGTATTTCCCTATGATTAACGGG + Intergenic
1056252196 9:84761101-84761123 TGGCCTTTTCTGTGATCATCTGG + Intronic
1058187608 9:101873544-101873566 TGGTTTTCCCCTTGATTATTTGG - Intergenic
1058193451 9:101945903-101945925 TGGATTACCCAGTGATAATCTGG - Intergenic
1058783507 9:108363469-108363491 TTGCTTTCCCTGGGATGAGCAGG - Intergenic
1059720740 9:116958028-116958050 TGGCTTTCTCAGTGCATATCAGG + Intronic
1061381396 9:130260654-130260676 TGGCTTTCCCTCTGGCTTTCTGG - Intergenic
1186645970 X:11507640-11507662 TGGCTTGCCCTGTCATTAATTGG - Intronic
1189629753 X:42940545-42940567 TGGCTGTCACTCTCATTATCAGG - Intergenic
1190460335 X:50667039-50667061 ATGCTTTCCCTTTGATTAGCTGG + Intronic
1192145023 X:68676273-68676295 TGGCTTGCTCTGAGATTTTCAGG - Intronic
1194356431 X:92890534-92890556 TTGATTTCCCTTTGATTAACCGG + Intergenic
1194448214 X:94012179-94012201 TGCCTTTGGCTGTGATTATTAGG + Intergenic
1194666016 X:96678376-96678398 TGGCTTTGCCTGTCAATAACAGG + Intergenic
1195735503 X:108008707-108008729 TGCCTTCCACTGTGATTATGAGG - Intergenic
1195945543 X:110206815-110206837 TGGGTTTCCCTGTAATAATATGG + Intronic
1198045414 X:132896900-132896922 TGACTTTCTCTGAGATTCTCTGG - Intronic
1198929883 X:141843701-141843723 GGGATTTGCCTTTGATTATCTGG - Intronic
1200664771 Y:6007534-6007556 TTGATTTCCCTTTGATTAACCGG + Intergenic
1202024794 Y:20510226-20510248 TTGTTTTCCATGTGATTATTGGG + Intergenic