ID: 1024973722

View in Genome Browser
Species Human (GRCh38)
Location 7:55094232-55094254
Sequence CAGGATAAGAAGCTGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 255}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024973722_1024973728 18 Left 1024973722 7:55094232-55094254 CCAGCATCCAGCTTCTTATCCTG 0: 1
1: 0
2: 2
3: 18
4: 255
Right 1024973728 7:55094273-55094295 CTGTCATCCACGCAGCTGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 194
1024973722_1024973726 -6 Left 1024973722 7:55094232-55094254 CCAGCATCCAGCTTCTTATCCTG 0: 1
1: 0
2: 2
3: 18
4: 255
Right 1024973726 7:55094249-55094271 ATCCTGGGAGAGATAGCTCTTGG 0: 1
1: 0
2: 0
3: 8
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024973722 Original CRISPR CAGGATAAGAAGCTGGATGC TGG (reversed) Intronic
900115301 1:1025589-1025611 CAGGATGAGAACCTGGAGTCAGG - Intronic
900516567 1:3085016-3085038 CAGGAAAAGGGGCTGGATGCTGG - Intronic
901848077 1:11997327-11997349 CAGGACAAGCAGCTCCATGCCGG + Exonic
903009617 1:20320449-20320471 TGGGATAAGAAGCTGGAGCCCGG + Intronic
903223865 1:21884265-21884287 CAGGATCTGAAGCTGGAAGCTGG + Intronic
903503278 1:23814092-23814114 CAGGATAAGAAGTTTGTGGCAGG + Intronic
906617174 1:47241387-47241409 CAGGAGAAGGAGCTGGAGGAAGG - Intergenic
908473615 1:64469123-64469145 CAGGATTAGAACCTGGATTTAGG - Intergenic
912532536 1:110336881-110336903 AAAGATAAAAATCTGGATGCTGG - Intergenic
914663209 1:149810896-149810918 CAGGAGAAGCACCTGGAAGCAGG + Intronic
918388542 1:184036161-184036183 GAGGACAAGGAGGTGGATGCTGG - Intronic
918562145 1:185881449-185881471 GAGAAGAAGAAGCTGGATACTGG - Intronic
922720142 1:227896148-227896170 CAGGGGAGGCAGCTGGATGCTGG - Intergenic
923441861 1:234028227-234028249 GAGGATCAGAAGCTGGATCGGGG - Intronic
924068971 1:240255696-240255718 AAGGAGAAGAAGCTGGCTGGTGG + Intronic
1063228152 10:4035273-4035295 CAGGCAAAGGAGCTGGATGCAGG + Intergenic
1066018843 10:31276365-31276387 CAGGATAAGAAGGCGGAAGCAGG + Intergenic
1068413947 10:56692355-56692377 CTGTATAAGAAGCATGATGCTGG - Intergenic
1069782785 10:70967355-70967377 CAGGAGCAAAAGCTGGATTCTGG + Intergenic
1072766560 10:98099234-98099256 AAGGAAAAGAAGATTGATGCAGG - Intergenic
1073128317 10:101167145-101167167 CAGGAGAAGGATCTGGCTGCAGG - Intergenic
1073938445 10:108663724-108663746 CAGGAAGAGAAGCTGGAAGGTGG + Intergenic
1074456652 10:113601304-113601326 CAGGAGAAGCAGCTGAAGGCTGG + Intronic
1075341736 10:121651748-121651770 CAGGATAAGAAACTGTATGCAGG - Intergenic
1075555657 10:123429613-123429635 CAAGCTAAGGAACTGGATGCGGG - Intergenic
1075667365 10:124240669-124240691 AAGGATAAGAACATGGATGGCGG - Intergenic
1076787184 10:132756802-132756824 CAGGAGATGAGGCTGCATGCGGG + Intronic
1079119613 11:17672518-17672540 GAGGACAAGGAGCTGGAAGCAGG - Intergenic
1082701852 11:56441902-56441924 GTGGATAAGCAGCTGGATGTTGG - Intergenic
1083169291 11:60913371-60913393 GAGGAGAAGCAGCTGGATGAGGG - Intergenic
1083310556 11:61781531-61781553 CAGGCTAAGAAGCTGGAAGCTGG - Intronic
1083607623 11:63988217-63988239 CAGGCTTAGAATCTGGAAGCAGG - Intronic
1085243539 11:75078356-75078378 TAGGATAAAAAGCTGGAGTCAGG - Intergenic
1085894454 11:80621730-80621752 CAGACTCAGAAGCTGAATGCGGG - Intergenic
1086089963 11:82995760-82995782 CAGGCTAAGAACCTGGAACCCGG + Intronic
1086286178 11:85253944-85253966 GAGGAGAAGCAGCTGGATGTTGG - Intronic
1087043190 11:93821327-93821349 CAGGATGATATGCTGGATGTTGG + Intronic
1088583585 11:111337769-111337791 CAGGATAAGATGATGTCTGCTGG - Intergenic
1088698833 11:112393413-112393435 TATGAAAAGAAGCTTGATGCAGG + Intergenic
1089684942 11:120140785-120140807 GAGGATAGAAAGATGGATGCTGG + Intronic
1091082184 11:132681373-132681395 GAGGAGAAGCAGCTGGATGTCGG + Intronic
1092465673 12:8729473-8729495 CAGGAGAAGCAGCTGGACGTCGG - Intronic
1095267958 12:40181936-40181958 GAGGATAAGCAGGTGGATTCTGG - Intergenic
1095612762 12:44149708-44149730 CAGAATAACAAGCTAGATGCTGG - Intronic
1096387645 12:51205338-51205360 CAGGATAAAAAGCTGCAGTCAGG - Intronic
1097072286 12:56363912-56363934 CAGGATGGGCAGCTGGGTGCTGG + Intergenic
1097535420 12:60863828-60863850 CAGGATAAGATGAGGGATGAAGG + Intergenic
1097703653 12:62845961-62845983 CAGGCTGAGAAGCTAGATGTGGG - Intronic
1101221309 12:102644133-102644155 CAAGCTAAGAAGCTGCCTGCTGG + Intergenic
1102616591 12:114159993-114160015 CAGGAAAGGAAGCTGAATGAGGG + Intergenic
1102995017 12:117342466-117342488 CCAGATAAGAAGGTGGATGGAGG + Intronic
1104265847 12:127231843-127231865 GAGGATAAGCAGCTGGACGTTGG + Intergenic
1105264571 13:18804629-18804651 CATGAAAAGAAGCTGAGTGCTGG + Intergenic
1105326256 13:19372925-19372947 CTGGTTAAGAACCTGGACGCTGG - Intergenic
1105867240 13:24472054-24472076 CTGGTTAAGAATCTGGACGCTGG + Intronic
1106147672 13:27064763-27064785 CAAGATAAAAAGCAGAATGCAGG + Intergenic
1106449985 13:29872282-29872304 GAGGACAAGAGGTTGGATGCTGG + Intergenic
1107454150 13:40538520-40538542 CAGTAGGAGAAGCTGGATGAAGG - Intergenic
1109375146 13:61483015-61483037 CTGGGTAAGAAACTGGATTCTGG + Intergenic
1111104677 13:83629733-83629755 GAGGAAAAGCAGCTGGATGTTGG - Intergenic
1111942339 13:94624015-94624037 CAGCATAAGCAGCTGGAGCCAGG + Intronic
1113709711 13:112455224-112455246 CAGGGAGAGAAGCTGGATGGAGG - Intergenic
1113887589 13:113669076-113669098 CAGGAAAAGAGGCTGAATGTTGG - Intronic
1115097065 14:29650012-29650034 CAGGAAAGGGAGCTGGAAGCAGG - Intronic
1115153715 14:30314809-30314831 GAGGAGAAGCAGCTGGATGTTGG + Intergenic
1115971651 14:38951383-38951405 CAAGCTGAGAAGCTGCATGCTGG - Intergenic
1119136999 14:72230191-72230213 CAGGAGAAGACGCTAGATCCAGG - Intronic
1122072526 14:99213867-99213889 CAGCATCAGAAGCAAGATGCTGG - Intronic
1202833884 14_GL000009v2_random:63439-63461 CATGAAAAGAAGCTGAGTGCTGG - Intergenic
1123871646 15:24581144-24581166 CTGGAGAAGAAGCTTGATGGTGG + Intergenic
1124383726 15:29189025-29189047 AAGGATATGAGGCAGGATGCAGG - Intronic
1125243360 15:37602911-37602933 CAGGAGGAGAAGCTGGAATCCGG + Intergenic
1125733890 15:41910217-41910239 CAGGAAATGAAACTGGAGGCTGG + Intronic
1125809728 15:42527780-42527802 CAGAATAAGAAGGCTGATGCTGG - Intronic
1126405713 15:48320618-48320640 GAGACTAAGAAGCTGGAGGCTGG - Intergenic
1128730118 15:70015203-70015225 CAGGAAGAGAGGCTGGAGGCAGG + Intergenic
1132113706 15:99120571-99120593 CAGGATACGATGCTGGGTGGGGG + Intronic
1132629867 16:911937-911959 CAGCATAAGAATGCGGATGCGGG + Intronic
1134278743 16:12799975-12799997 CTGGATAAGAATGGGGATGCTGG - Intronic
1135676136 16:24416559-24416581 CAGGAGAAGAACCTGAATGCTGG + Intergenic
1135967677 16:27049391-27049413 CAGGCTGAGAAGCTGGAGTCAGG - Intergenic
1136512978 16:30750409-30750431 CAGGATTTGAGGCTGGATCCTGG + Intronic
1137360034 16:47805921-47805943 CAGGATAAGAAGCTAGTGGTGGG + Intergenic
1137381821 16:48006546-48006568 CTGTATAAGAAGCATGATGCTGG + Intergenic
1138677881 16:58665243-58665265 CAGGAGAAGGAGCTGGAATCTGG - Exonic
1139046128 16:63061975-63061997 GGGGATAAGTAGCTGGATGTAGG - Intergenic
1139558894 16:67729394-67729416 GAGGATGAGGAGCTGGGTGCAGG + Exonic
1142135363 16:88449511-88449533 CAGGGGCAGAAGCTGGAGGCCGG - Intergenic
1144729420 17:17518018-17518040 CAGGCTAAGAAGCTGCATCCTGG - Intronic
1145017617 17:19409431-19409453 CTGGGTGAGAACCTGGATGCGGG - Intergenic
1147039054 17:37703130-37703152 TAGGATGAGAAACTGGTTGCAGG - Intronic
1148758077 17:49985059-49985081 CAGGAGAAGCAATTGGATGCTGG + Intergenic
1152886483 17:82854046-82854068 TAGGCTAAGAAGCTGGCTGTTGG - Intronic
1153261546 18:3229070-3229092 CAGGACTAGAAGCTGGAAGCAGG + Intergenic
1154148341 18:11885195-11885217 CAGCATCATGAGCTGGATGCAGG + Exonic
1154423820 18:14256932-14256954 CATGAAAAGAAGCTGAGTGCTGG - Intergenic
1157713634 18:49867067-49867089 CAGGGAAGGAAGCTGGATCCAGG + Intronic
1158390264 18:57039251-57039273 GAAGATAAGGAGCTGGATGTTGG + Intergenic
1159465101 18:68771335-68771357 CAAGATAAGAAGCTGTAAGAGGG + Intronic
1159778537 18:72632871-72632893 CAGGATAGGAAGCTCCTTGCAGG + Intronic
1161411506 19:4120769-4120791 CAGGAGAGGAAGCTGGCTGTAGG - Intronic
1162135127 19:8550644-8550666 CAGGACCAGCTGCTGGATGCTGG + Exonic
1163125472 19:15242112-15242134 CAGCAAAAGCTGCTGGATGCAGG - Intronic
1164874133 19:31671314-31671336 AAGGGTGAGAAGGTGGATGCAGG - Intergenic
1165825701 19:38704661-38704683 CAGGAGAAGGAGCTGGCTGCGGG + Intronic
1167690607 19:50982316-50982338 CAGGAGAAGAAGGTGAAAGCTGG - Exonic
1202638797 1_KI270706v1_random:64253-64275 CATGAAAAGAAGCTGAGTGCTGG + Intergenic
925286187 2:2717128-2717150 CAGGAGAAGAGGGAGGATGCCGG + Intergenic
925458815 2:4042550-4042572 CAGGAGAAGAGGCTGAATGGAGG - Intergenic
925857551 2:8144809-8144831 GAGGGGAAGAAGCTGGAAGCTGG + Intergenic
926309762 2:11667038-11667060 CAGGACAAGAACATGGCTGCTGG - Intronic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
927867014 2:26595689-26595711 CAGGACAAGAAAATTGATGCAGG - Intronic
928813088 2:35253497-35253519 GAGGAGAAGCAGCTGGATGTCGG + Intergenic
928838016 2:35570133-35570155 CATTATAAGAAGCTGTATGAAGG - Intergenic
929298052 2:40270838-40270860 TAAGATAAGAAGCTGGCAGCAGG + Intronic
930001787 2:46866593-46866615 AAAGATAAGAAGCTGGAGGTTGG + Intergenic
930933565 2:56919045-56919067 CAGGCAAAGAAACTTGATGCTGG + Intergenic
931987013 2:67751818-67751840 CATGATAAGATGCTGGCTGGTGG + Intergenic
932720469 2:74135078-74135100 CAGGAAAAGAACCCGGATCCTGG + Intronic
935116377 2:100140329-100140351 CATGGTGAGGAGCTGGATGCTGG - Intronic
937902388 2:127030684-127030706 TAAGAGAAGAAACTGGATGCAGG + Intergenic
938942486 2:136181271-136181293 GAGGAGAAGCAGCTGGATGTTGG - Intergenic
940638796 2:156327832-156327854 CAGGGTAAGAAGCTGGCGGGGGG - Exonic
940885826 2:158988574-158988596 AAGGAAAAGAAGCTGGGAGCTGG - Intronic
941465733 2:165824339-165824361 CAGAATAAGAAGATGGAAGGAGG - Intergenic
943507625 2:188781604-188781626 CTTGAGAATAAGCTGGATGCTGG - Intronic
943834366 2:192500424-192500446 GAGGAGAAGCAGCTGGATGATGG + Intergenic
946377965 2:219325338-219325360 CAGGATGAGAAGCAGAATCCCGG + Intergenic
946471395 2:219964285-219964307 GAGGAGAAGCAGCTGGATGTAGG + Intergenic
947563705 2:231179969-231179991 CAGGATTAGAAGCCTGATGGAGG + Intergenic
948125774 2:235563894-235563916 CAGGTTAAGAAGCTTGCTCCAGG + Intronic
948617671 2:239211765-239211787 CAGTTTAAGATGCTGGATTCTGG - Intronic
1170645180 20:18191397-18191419 CAGGTTAAGAGGCTGGAAGGTGG + Intergenic
1173171394 20:40727156-40727178 CAGGACAACAAGCTGGATTCAGG - Intergenic
1173226498 20:41165242-41165264 CAGCACAAGAAGCTGGCTGAGGG + Exonic
1173521436 20:43703133-43703155 CAGGAGGAGAAGGAGGATGCTGG + Intronic
1174834091 20:53839800-53839822 CAGGGTGAGGAGCAGGATGCAGG - Intergenic
1174862342 20:54102667-54102689 CAGAATACAAAGCTGGATGCAGG - Intergenic
1175605599 20:60310040-60310062 CAGGTCAAGAAGCTGGGTACAGG - Intergenic
1178296919 21:31417869-31417891 CAGGACAAGAGGCTTGAGGCTGG + Intronic
1178529933 21:33367541-33367563 CAGGAACAGAAGCTGCATGCGGG + Intergenic
1178723705 21:35032761-35032783 AAGGGTAAGAAGCTGTATGTGGG - Intronic
1178885159 21:36479324-36479346 CAGGAAAGGAAGCTGCAGGCTGG - Intronic
1180132249 21:45834242-45834264 CAGGAAAAGAAGCTGCCAGCCGG - Intronic
1180363169 22:11917636-11917658 CATGAAAAGAAGCTGAGTGCTGG - Intergenic
1182497760 22:30722114-30722136 CAAGACAAGAAGCTGGGAGCTGG - Intronic
1182763956 22:32745191-32745213 CTGGATGGGAAGCTGGGTGCTGG - Intronic
1183243510 22:36675712-36675734 CAGGTTAACAGGCTGGAGGCAGG - Intronic
1183463641 22:37968170-37968192 CACGATAAGAGGCTCGAAGCAGG - Exonic
1184321717 22:43746976-43746998 CCAGATAAGCAGCAGGATGCTGG - Intronic
1184634726 22:45817976-45817998 CAGGGTGAGAAGCTGGAAGTTGG + Intronic
1184961994 22:47936677-47936699 CAGGATAAAAAGCAGGCAGCCGG - Intergenic
949519585 3:4837584-4837606 ATGGATAGGAAGCAGGATGCGGG + Intronic
950254501 3:11493311-11493333 GAGGAGAAGCAGCTGGATGTTGG - Intronic
953946349 3:47151496-47151518 CAGGATATGAAACTGGGAGCAGG - Intronic
955559175 3:60170190-60170212 CAGGTTAATAAGATGGATGGAGG + Intronic
956086514 3:65616824-65616846 CAGGATAAAGAACTGGATGTTGG - Intronic
956837481 3:73107317-73107339 CAGGATATGAACCCAGATGCTGG + Intergenic
957978210 3:87474375-87474397 AAGGATAAGAAGTTTGCTGCAGG + Intergenic
959814313 3:110657796-110657818 CAGAAAAAGAAGATTGATGCTGG + Intergenic
960898632 3:122532089-122532111 CAGGTGATGAAGCTGGATGAGGG - Intronic
964314523 3:155429265-155429287 AAGGATAAGAAGCTTGGTCCAGG - Intronic
964678690 3:159313591-159313613 CATGAGGAGAAACTGGATGCAGG - Intronic
964807619 3:160628849-160628871 AGGCATAAGAAGCTGGTTGCAGG + Intergenic
968045683 3:195622746-195622768 GAGGATATGAAGCTGGAGACTGG - Intergenic
968064396 3:195750511-195750533 GAGGATATGAAGCTGGAGACTGG - Intronic
968308973 3:197667341-197667363 GAGGATATGAAGCTGGAGACTGG + Intergenic
970291565 4:14578595-14578617 CAGGATAAGAACCTTTATTCTGG - Intergenic
970848136 4:20567594-20567616 AAGGAGAAGAAGATGGATTCTGG + Exonic
973369046 4:49230640-49230662 CATGAAAAGAAGCTGAGTGCTGG + Intergenic
973391996 4:49564776-49564798 CATGAAAAGAAGCTGAGTGCTGG - Intergenic
974247851 4:59344609-59344631 CTGGATAAGAAGTAGCATGCTGG + Intergenic
975904870 4:79197400-79197422 CATGGTAAGAAGATAGATGCAGG - Intergenic
975967172 4:79987158-79987180 CAGAATCAGAATCTGGATGGCGG + Intronic
976085077 4:81399501-81399523 GAGGATAAGAATCTGGAATCTGG + Intergenic
976319229 4:83692542-83692564 CAGGAGGAGAAGCTGGTTCCAGG - Intergenic
977223083 4:94361146-94361168 CAAGAGAGGAAGCTGGATACAGG - Intergenic
979192747 4:117882883-117882905 TAGGAAATGAAGCAGGATGCGGG + Intergenic
979715097 4:123828393-123828415 CAGGGAAACAAGCTTGATGCTGG - Intergenic
980819801 4:137999366-137999388 CAGGATGAGAAAATGGGTGCTGG + Intergenic
983141978 4:164161354-164161376 CAGCATAGGAAGCATGATGCTGG - Intronic
984105567 4:175541271-175541293 GAGGAAAAGTAGATGGATGCTGG - Intergenic
984359646 4:178711806-178711828 GAGGAGAAGCAGCTGGATGTTGG - Intergenic
984842482 4:184081017-184081039 CAGGCAAAGAAGCTGCATTCTGG + Intergenic
984935711 4:184887998-184888020 CAGGAAAGGAAGCTGGGAGCAGG - Intergenic
1202766138 4_GL000008v2_random:150112-150134 CATGAAAAGAAGCTGAGTGCTGG + Intergenic
985807741 5:2059525-2059547 GAGGAGAACAAGCTGGAAGCAGG + Intergenic
986182214 5:5403822-5403844 CAGGCTAAGAAGCAAGAAGCAGG + Intergenic
988439777 5:31219612-31219634 CAGGATGAGAAACTCCATGCAGG - Intronic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
993651988 5:90533137-90533159 CACGAAAACAAGCAGGATGCAGG - Intronic
999461000 5:151757751-151757773 AAGGATAAGGAGCTGAATCCTGG + Intronic
1000872917 5:166599749-166599771 CATGAAAGGAAGTTGGATGCTGG + Intergenic
1001002975 5:168024985-168025007 CCTGATAAGCACCTGGATGCTGG - Intronic
1001402560 5:171454342-171454364 CAGGCAAAGAACCTGGATTCAGG + Intronic
1001719974 5:173848796-173848818 AAGAAGAAGAAGCTGGAGGCAGG - Intergenic
1002462099 5:179379071-179379093 CAGAACAAGAACCAGGATGCAGG - Intergenic
1004495156 6:16156116-16156138 GAGGAGAAGCAGCTGGATGTTGG - Intergenic
1004680366 6:17888006-17888028 TAGGATAAGAATCAAGATGCAGG - Intronic
1004788744 6:18999396-18999418 CAATGTAAGAAGATGGATGCTGG - Intergenic
1006177054 6:32128765-32128787 CAGGGGAAGAACCAGGATGCAGG - Exonic
1006596092 6:35193416-35193438 CAAGATAAGAACTTGGAAGCAGG + Intergenic
1008043650 6:46829614-46829636 GAGGAGAAGAAGCAGGATCCCGG - Intronic
1008255791 6:49297978-49298000 GAGGAGAAGCAGCTGGATGTTGG - Intergenic
1010009888 6:71037576-71037598 CTGTATAAGAAGCATGATGCTGG + Intergenic
1014179303 6:118367364-118367386 CAGTATTAGGAGCTGGATGATGG - Intergenic
1015343637 6:132130696-132130718 CAGGAAAAGAAGGCAGATGCTGG - Intergenic
1015851708 6:137580886-137580908 CTGGCTAAGTAGCTGGTTGCAGG - Intergenic
1016352335 6:143181852-143181874 CAGGATAAGAAGTTGGAAAAGGG + Intronic
1017764218 6:157593557-157593579 CAGGAAAAGAGGCAGGATCCGGG + Intronic
1017820309 6:158044279-158044301 CAGGCTAAGAAGCTGAACCCAGG - Intronic
1017908451 6:158772748-158772770 AATGGTCAGAAGCTGGATGCTGG - Intronic
1018211992 6:161491002-161491024 CTGGATAGGAAGCATGATGCTGG - Intronic
1020527573 7:9282088-9282110 CTGTATAGGAAGCAGGATGCTGG + Intergenic
1022597039 7:31722655-31722677 CAGGTGAAGAAGCAGGATGGTGG + Intergenic
1023976702 7:45035618-45035640 CAGGTGAAGAAGGCGGATGCAGG + Intronic
1024414590 7:49089883-49089905 CAGGAGAAGACGATGTATGCAGG + Intergenic
1024655302 7:51446897-51446919 CAGGATAAAAAACAGGATGGAGG - Intergenic
1024973722 7:55094232-55094254 CAGGATAAGAAGCTGGATGCTGG - Intronic
1025141714 7:56472268-56472290 CAGGATAAGAAGTTGAGTGTTGG - Intergenic
1025611758 7:63080752-63080774 CAGGATAAGAAGTTGAGTGTTGG + Intergenic
1029275304 7:99400431-99400453 CAGGGCAAGAAGCTGGTTGTTGG + Intronic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1033168237 7:139060023-139060045 CAGGTTAACAGCCTGGATGCTGG - Intronic
1034033806 7:147798958-147798980 CAGGCAAAGAAGATGGATGATGG + Intronic
1035184024 7:157111887-157111909 GAGGAGAAGCAGCTGGATGTTGG - Intergenic
1035679768 8:1479292-1479314 CAGAATAAGATGCTGGGCGCAGG + Intergenic
1035816224 8:2544017-2544039 CAGGTGATGAAGCTGGATGCAGG - Intergenic
1036217638 8:6893958-6893980 CAGTATAAGAGGCTGGGTGGCGG + Intergenic
1036582259 8:10086271-10086293 CAGGTTGAGCAGTTGGATGCTGG + Intronic
1036637951 8:10564503-10564525 CAGGGTAGGAAGCTGGCTCCGGG - Intergenic
1038567124 8:28628995-28629017 CAGAATGAGAAGCTGGAAGGTGG + Intronic
1038693734 8:29786290-29786312 CAGGATAATAGGCTGGAAGATGG - Intergenic
1039634399 8:39147623-39147645 CAGAGGAAGAAGGTGGATGCTGG - Intronic
1039661347 8:39470695-39470717 GAGGAGAAGCAGCTGGATACTGG + Intergenic
1040846894 8:51852935-51852957 CTGGAGAAGAAACAGGATGCAGG + Intronic
1042795765 8:72662059-72662081 CAGGATGAAGAACTGGATGCTGG - Intronic
1042937346 8:74073226-74073248 CAGGAGAAGAAGCTGAAGGAGGG + Intergenic
1043815723 8:84798824-84798846 CAAGAGAAAAAGCAGGATGCGGG + Intronic
1044189442 8:89297555-89297577 CAGCACAAGAAGCCCGATGCTGG + Intergenic
1044274680 8:90285838-90285860 AAGGAGAAGCAGCTGGATGTTGG - Intergenic
1045973176 8:108102647-108102669 CATGAAAAGAAGCTGGAGGCTGG + Intergenic
1048874550 8:138826899-138826921 CAGGCCAAGAAGGTGGATGGTGG - Intronic
1052865252 9:33460945-33460967 CAAGATGAGAAGCTGCATGTGGG - Intergenic
1053662864 9:40296584-40296606 CATGAAAAGAAGCTGAGTGCTGG - Intronic
1053664236 9:40306291-40306313 CATGAAAAGAAGCTGAGTGCTGG - Intronic
1053913312 9:42926759-42926781 CATGAAAAGAAGCTGAGTGCTGG - Intergenic
1054374993 9:64442808-64442830 CATGAAAAGAAGCTGAGTGCTGG - Intergenic
1054520380 9:66069994-66070016 CATGAAAAGAAGCTGAGTGCTGG + Intergenic
1054521750 9:66079700-66079722 CATGAAAAGAAGCTGAGTGCTGG + Intergenic
1055057512 9:72037422-72037444 TAGGAAAAGAAGCTCGATGAGGG + Intergenic
1055407542 9:75990226-75990248 CAGGCTAACGAGCTGGAGGCAGG - Intronic
1056366215 9:85907849-85907871 AGGGATAAAAAGCTGGTTGCTGG - Intergenic
1057147511 9:92768212-92768234 CAGGAGAAGCAGCTGGATGTCGG - Intergenic
1058172125 9:101694449-101694471 CATGATTAGAAGCTTGGTGCAGG - Intronic
1058293139 9:103269727-103269749 CAGCAGAAGAAGCATGATGCTGG + Intergenic
1058544498 9:106046154-106046176 CAGGATAGGAAACTGTATGCAGG + Intergenic
1059409583 9:114123722-114123744 CAGGATATGAAGTTGGTTCCAGG - Intergenic
1059411477 9:114135063-114135085 CAGGACAAGAAGCCAGAGGCAGG + Intergenic
1060015433 9:120082558-120082580 CAGGCTAAGAAACTGGCTGCTGG - Intergenic
1060060325 9:120454018-120454040 CAGGATAAAATACTGGATGTGGG - Intronic
1060295151 9:122338296-122338318 CAGGATAGGAGGCTGGAGGATGG - Intergenic
1061531682 9:131218926-131218948 CAGGCTCAGAAGGTGGGTGCAGG - Intronic
1061629637 9:131863959-131863981 GAGGATAAGGAGCTGGATCCAGG - Intronic
1061666669 9:132163980-132164002 CAGAGTAAGAAGCTGCATCCCGG - Intronic
1062585523 9:137247753-137247775 CAGGGAAGGGAGCTGGATGCCGG - Exonic
1187695963 X:21920672-21920694 CAGGATAATAAGATGGCAGCTGG - Intergenic
1188553245 X:31383692-31383714 GAGGAGAAGCAGCTGGATGTTGG + Intronic
1189394033 X:40604026-40604048 CAGGAGATGAAGCTAGAAGCAGG - Intronic
1190048271 X:47129755-47129777 CAGGAAAACAATCTGGAGGCGGG + Intergenic
1192300892 X:69901422-69901444 CAGGTTAAGAAGATAGATGGAGG + Intronic
1193340222 X:80339683-80339705 CAAGATGAGAAGCTGAATGTAGG + Intronic
1195065773 X:101236958-101236980 CATGGTAGGAAGCTGGAGGCTGG - Intronic
1197190609 X:123643244-123643266 CAGGAAAGGAGGTTGGATGCAGG + Intronic
1197727232 X:129784427-129784449 CAGGGTAAGAGGCTGGAGGTGGG + Intronic