ID: 1024977087

View in Genome Browser
Species Human (GRCh38)
Location 7:55123583-55123605
Sequence AATTGCTGGCAGCAGCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024977083_1024977087 17 Left 1024977083 7:55123543-55123565 CCTTGTGAAATATCTTCAGAGTC 0: 1
1: 0
2: 1
3: 14
4: 199
Right 1024977087 7:55123583-55123605 AATTGCTGGCAGCAGCTTGAGGG No data
1024977082_1024977087 20 Left 1024977082 7:55123540-55123562 CCTCCTTGTGAAATATCTTCAGA 0: 1
1: 0
2: 4
3: 23
4: 229
Right 1024977087 7:55123583-55123605 AATTGCTGGCAGCAGCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024977087 Original CRISPR AATTGCTGGCAGCAGCTTGA GGG Intronic
No off target data available for this crispr