ID: 1024978976

View in Genome Browser
Species Human (GRCh38)
Location 7:55140977-55140999
Sequence TAGAATCATTCCCATGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024978972_1024978976 -9 Left 1024978972 7:55140963-55140985 CCAATGATACTCTTTAGAATCAT 0: 1
1: 0
2: 1
3: 15
4: 192
Right 1024978976 7:55140977-55140999 TAGAATCATTCCCATGGGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 169
1024978971_1024978976 18 Left 1024978971 7:55140936-55140958 CCATGGCTCATTGAGAGGGCAGA 0: 1
1: 0
2: 0
3: 18
4: 187
Right 1024978976 7:55140977-55140999 TAGAATCATTCCCATGGGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024978976 Original CRISPR TAGAATCATTCCCATGGGGA AGG Intronic
901784608 1:11616519-11616541 TAGAGTCCTTCCCATGGGCGGGG + Intergenic
905258165 1:36698846-36698868 TAGTCTCATTCCTATGTGGAAGG - Intergenic
907812054 1:57880538-57880560 TACATTCATTCCGATAGGGATGG - Intronic
910803699 1:91170092-91170114 TAGAATGAGTCCCATGAGGTTGG - Intergenic
912210442 1:107551173-107551195 TAGAATTATTCCAATGGGTTTGG + Intergenic
912495553 1:110089167-110089189 TAGAAACATGCCCCGGGGGATGG + Intergenic
915608380 1:156969912-156969934 TGGAATCTGCCCCATGGGGAGGG + Intronic
915848763 1:159298380-159298402 TGAACTCATTACCATGGGGAAGG - Intronic
916370653 1:164090671-164090693 TAGAATCACTAACATAGGGATGG + Intergenic
916795673 1:168165067-168165089 TAGAAACAGGCCCAGGGGGACGG - Intergenic
918895500 1:190338056-190338078 TTGAATCATTGCAATAGGGAGGG - Intronic
920235738 1:204503061-204503083 CAGAATGATTACCATGGGGCTGG + Intergenic
921220124 1:212967707-212967729 TAGACTCATGGCCCTGGGGATGG + Intronic
1063336127 10:5216218-5216240 AACACTCATTACCATGGGGAGGG + Intronic
1068910426 10:62374066-62374088 TGGGATCATTCCCCGGGGGAGGG - Intergenic
1069879961 10:71585978-71586000 CAGACTCCTGCCCATGGGGAGGG - Intronic
1070732069 10:78836893-78836915 TAGAATCATTCCCATCAGTCAGG + Intergenic
1073244127 10:102077513-102077535 TATAATCAGTCCCATGGAGTTGG - Intergenic
1074704532 10:116119180-116119202 TTGACTCCATCCCATGGGGAGGG - Intronic
1075493767 10:122900249-122900271 TAGAATCATACTCAAGGGGGAGG - Intergenic
1076116599 10:127905948-127905970 TAGAGTCATTCCCATACGGATGG + Intergenic
1076838419 10:133032736-133032758 TAGCCACATTCCCATGAGGAGGG - Intergenic
1077811749 11:5644887-5644909 TGTATTCATTACCATGGGGATGG - Intronic
1079428038 11:20362870-20362892 TATAATAACTCCCATGGAGATGG + Intergenic
1082936867 11:58664438-58664460 TAGAAACAATACCATGGGGGGGG + Intronic
1082936911 11:58664664-58664686 TAGGAACAATACCATGGGGAGGG + Intronic
1086247687 11:84773850-84773872 TAGAAGCATTCCCCTTGAGAAGG + Intronic
1088798733 11:113286590-113286612 TAGAGTGCTTCCCATGGGGATGG + Intergenic
1089828369 11:121300673-121300695 TAGAATGATTCCCATGAGCAGGG + Intronic
1090867547 11:130715133-130715155 TTGAAGCATTTCCATGGGAAAGG + Exonic
1092970359 12:13688113-13688135 TAGAATCATTCAGAAGTGGATGG - Intronic
1093962939 12:25294907-25294929 TAAAACCATTTCCAGGGGGAAGG + Intergenic
1098775715 12:74612491-74612513 TAGCATCATTCTCATGGTTAAGG - Intergenic
1100614682 12:96221926-96221948 CAGAATAATTGCCTTGGGGAGGG - Intronic
1103225413 12:119283345-119283367 TAAATTTATTCCCATGGAGAGGG - Intergenic
1104752712 12:131250297-131250319 TAGAATCATTCCCCAGGAGCTGG + Intergenic
1104779164 12:131408693-131408715 TAGAATCATTCCCCAGGAGGTGG - Intergenic
1106769216 13:32945407-32945429 TAGGATCATGCCCTTGGAGATGG + Intergenic
1109072099 13:57783336-57783358 TGGAATCATTCCCATTGAAAAGG - Intergenic
1110162277 13:72392856-72392878 TAGAATAATTGCCCTGGAGAGGG - Intergenic
1111516078 13:89333556-89333578 TAGAAACATTCAAAAGGGGAAGG - Intergenic
1111691754 13:91572615-91572637 TGAAATCATGACCATGGGGAGGG + Intronic
1111933595 13:94536506-94536528 TTAAATCATGACCATGGGGAGGG - Intergenic
1112225743 13:97538217-97538239 TAGAAGCATTCCCATTGTAATGG + Intergenic
1112506124 13:99976952-99976974 TAGAATCACTCCCATCAGGAAGG + Intergenic
1114589198 14:23844194-23844216 TAGAAACCTTACCATGGGGAAGG + Intergenic
1115680860 14:35736600-35736622 AAGAAGCATTTCAATGGGGAAGG + Intronic
1115877830 14:37880511-37880533 TGAACTCATTACCATGGGGAGGG - Intronic
1116727863 14:48585066-48585088 TAGAATCACTGCGATGAGGATGG + Intergenic
1118307519 14:64667649-64667671 AGGACTCATTACCATGGGGAGGG + Intergenic
1120474705 14:84972671-84972693 TAGAATGTCACCCATGGGGACGG - Intergenic
1122234993 14:100326337-100326359 CAGAACTATTCCCATGTGGAAGG - Intronic
1122533443 14:102445311-102445333 TACAGTCATTCCCTTGGTGAGGG + Intronic
1122653982 14:103244695-103244717 AAGGCTCATTCCCATGGGGGGGG + Intergenic
1125907354 15:43405381-43405403 TCCCATCATTCCCATGTGGAAGG + Exonic
1127013905 15:54661191-54661213 TAGACACTTTCCCATGGGAATGG - Intergenic
1127730731 15:61799867-61799889 TAGAATCACTCCCATTGAAATGG - Intergenic
1128443914 15:67739943-67739965 TAGAAACATTACCATGTGGTAGG + Intronic
1128777065 15:70328762-70328784 TAGAATCATGCGCAAGGTGAAGG - Intergenic
1130747211 15:86668094-86668116 TTCACTCGTTCCCATGGGGAGGG + Intronic
1132020668 15:98359211-98359233 TTTAATCCTTCCCTTGGGGAGGG - Intergenic
1135634854 16:24066802-24066824 TACAATAATTCCCAAGTGGATGG - Intronic
1137418400 16:48307996-48308018 TGAACTCATTACCATGGGGAAGG + Intronic
1139370729 16:66467882-66467904 TAGAAACATGCCCTTGGGGCAGG - Intronic
1140623235 16:76762177-76762199 TGCACTCATTGCCATGGGGATGG - Intergenic
1140822169 16:78672849-78672871 TAGAATCATCGCCTTGGTGATGG + Intronic
1143491016 17:7285221-7285243 CAGGACCATTCCCATGGGGTGGG - Intronic
1144427141 17:15153875-15153897 TACACTCATTACCATGGGGAAGG + Intergenic
1148678097 17:49456757-49456779 TAGCATCCCTCCCATGGGAAGGG - Intronic
1149663058 17:58345960-58345982 TAGAGTCCTTGGCATGGGGAAGG + Exonic
1150270399 17:63860715-63860737 AAGAATCATACCCATTGGCAGGG + Intergenic
1150969301 17:70009577-70009599 TGAACTCATTACCATGGGGAAGG - Intergenic
1150969561 17:70011551-70011573 TGAACTCATTACCATGGGGAGGG - Intergenic
1152937206 17:83146183-83146205 CAGAATCAGTGCCAAGGGGATGG - Intergenic
1156333768 18:36150420-36150442 GAGAAACATTCTAATGGGGATGG - Intronic
1156472579 18:37387106-37387128 TAGAATCTGTACCATGGGCAAGG - Intronic
1157042477 18:44057128-44057150 TTCACTCATTACCATGGGGAAGG - Intergenic
1158189753 18:54813462-54813484 TCCACTCATTACCATGGGGAGGG - Intronic
1159103737 18:63982616-63982638 TACAATAATTACCATGGGAAGGG + Intronic
1159314857 18:66759171-66759193 CAGAATCAGGCCCATGGAGAAGG - Intergenic
1161241699 19:3226631-3226653 TAGAAAGATTCCCGTGGGAATGG + Intronic
1162322646 19:9979054-9979076 CAGAATCAGTCTCATGGGGGAGG - Intronic
1165964765 19:39567133-39567155 GAGAATCATACCCATGAGTAGGG + Intergenic
926792775 2:16592012-16592034 TAAATTCATTCCTGTGGGGAGGG + Intronic
928030501 2:27774355-27774377 TAAAATCAGTCACAGGGGGATGG - Intronic
928898228 2:36289829-36289851 TAGAAACATTCCTATGAGGTTGG + Intergenic
930204347 2:48573149-48573171 TGGAATCATGCCCGTGGGAAAGG - Intronic
930810729 2:55537537-55537559 ATGAATAATTCCCAAGGGGATGG + Exonic
932261222 2:70329307-70329329 TAGAGTGATTCCCATGGGCAGGG - Intergenic
932897134 2:75651126-75651148 TAGAGTCCTTGCCATGGGCAAGG + Intronic
933700113 2:85248978-85249000 TTGACTCATTCCCTTGGGGAGGG + Intronic
938187239 2:129242679-129242701 TACAATCTTCCCCATGGGCAGGG + Intergenic
939470691 2:142616135-142616157 TAGATTCCTCCTCATGGGGAAGG + Intergenic
940263804 2:151815386-151815408 TAGAATAATGGCGATGGGGAAGG - Intronic
941486275 2:166086299-166086321 TAGAATCATTCCCTAGTGGGTGG - Intronic
943159036 2:184222545-184222567 TACAAACAATCACATGGGGAGGG + Intergenic
945147327 2:206752433-206752455 AGGAATCATTCCGATGGGGGCGG - Intronic
945292071 2:208136600-208136622 AGGAATCTTACCCATGGGGAGGG - Intergenic
946825441 2:223672957-223672979 TGAACTCATTACCATGGGGAGGG + Intergenic
947197348 2:227582250-227582272 TGAACTCATTACCATGGGGAAGG - Intergenic
947695906 2:232188233-232188255 TGGAATGATTGCCATGGGTATGG + Intronic
1168801475 20:646071-646093 TAGACTCATTCCACTGGGGATGG + Intergenic
1168843715 20:927345-927367 CATAACCATTCCCAAGGGGAAGG + Intergenic
1170148536 20:13204391-13204413 TAGAATTCTTCCCCTGGGCATGG + Intergenic
1173562225 20:44014194-44014216 TAGGATCATTCACATGGTGATGG + Intronic
1176218610 20:63959615-63959637 CAGACACATTCCCATGAGGAGGG + Exonic
1184464043 22:44658720-44658742 AAGAGCCATTCCCACGGGGAGGG + Intergenic
950079877 3:10213882-10213904 AAGATTTATTCCCATGTGGAAGG - Intronic
950201070 3:11044425-11044447 CAAACTCATTACCATGGGGAGGG - Intergenic
950364344 3:12472355-12472377 GAGAATCATTCCTATAGGCAGGG - Intergenic
950726148 3:14918347-14918369 TAGGCTCTTTACCATGGGGAAGG + Intronic
954221107 3:49154474-49154496 TGGAATTATCACCATGGGGAAGG - Intergenic
955143576 3:56293535-56293557 AAGGATCATTCCCATGAGAAGGG - Intronic
956549129 3:70439338-70439360 TAGAATCTTGCCCATAGTGAAGG + Intergenic
958788336 3:98623198-98623220 TGGAGTCATTACCACGGGGAGGG + Intergenic
959245384 3:103861715-103861737 TTCACTCATTACCATGGGGAAGG - Intergenic
961716838 3:128863683-128863705 TAGAATCATACAAATGTGGAAGG - Intergenic
962363914 3:134764616-134764638 AAGAAGCATTGCGATGGGGAAGG - Intronic
962419929 3:135218938-135218960 TGGGATCATTCCCATGAGGGAGG - Intronic
962600877 3:136990090-136990112 TAGCACCCTTCCCATGGGGAGGG - Intronic
963352579 3:144170143-144170165 TCAAGTCATTACCATGGGGAAGG - Intergenic
963874160 3:150454919-150454941 TAGAATGATTCCCATAGCTAAGG - Intronic
967011513 3:185439225-185439247 TGGATTCATTTCCTTGGGGAAGG + Intronic
967570740 3:191025661-191025683 TAAAATTATCCCCATGGGGCTGG - Intergenic
969260936 4:6033090-6033112 CAGAATCATTCCGCTGGGAAAGG + Intronic
970426533 4:15950942-15950964 TAGACTCCTGCCCATGGGGCAGG + Intergenic
976323901 4:83749436-83749458 TAGAATCATGGCCTGGGGGAAGG + Intergenic
981061577 4:140430946-140430968 TGGATTCATTCCCATGAGAATGG + Intergenic
988914850 5:35882136-35882158 TAGAATGATCCCCCTGGTGAAGG + Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
991988839 5:72317797-72317819 TAGAACCATCCCCCTGGGGCAGG - Intronic
992368147 5:76114250-76114272 TGGCATTATTCCCATGGTGATGG - Intronic
993100668 5:83535834-83535856 TAGTATTATTCCTATGGGCAGGG + Intronic
995498662 5:112778295-112778317 TAAAATCATTGACATGGAGAGGG - Intronic
998352704 5:141511756-141511778 AAGCATCAGTACCATGGGGATGG - Exonic
999829563 5:155305801-155305823 TAAAATCATTCCTCTGGAGAAGG - Intergenic
1001315876 5:170641057-170641079 TTGAATCTTTTCCTTGGGGAAGG - Intronic
1002802430 6:537701-537723 TTTAATCATTCTCATGGTGATGG - Intronic
1003046232 6:2735599-2735621 GAGAATGATCCCCATGGGGACGG + Intronic
1003166149 6:3680140-3680162 TAGAATCACTCCAAAGAGGATGG - Intergenic
1004333012 6:14738665-14738687 TTGGATCATTTCCAAGGGGAAGG - Intergenic
1005327150 6:24713381-24713403 TAGCAACATTACCATGGGGCGGG + Intronic
1007299535 6:40856395-40856417 TGGAAACTTTCCCATGGGAAAGG - Intergenic
1009228069 6:61035582-61035604 TAGAAACAATATCATGGGGAGGG + Intergenic
1009317598 6:62240753-62240775 TAGAATAATTTCCATGGTAAAGG - Intronic
1010239836 6:73604957-73604979 TAAAATCAACCCCATGAGGAAGG + Intronic
1010974780 6:82299425-82299447 CACACTCATTACCATGGGGAGGG + Intergenic
1011278266 6:85650915-85650937 TAGAATCAGTGTCATGAGGAGGG + Intergenic
1011629707 6:89311768-89311790 TCACATCATCCCCATGGGGAAGG + Intronic
1014096879 6:117470754-117470776 GAGAAACATTCTAATGGGGATGG - Intronic
1015890137 6:137962448-137962470 TAGAATGATTGCCATGGGTAAGG - Intergenic
1018247680 6:161838492-161838514 TAGCATCATTCCCATCTGGCAGG + Intronic
1018281396 6:162189602-162189624 TAGATTCATTTCCTTGGGGCAGG - Intronic
1019401867 7:859408-859430 TAGGATGATTCCCAAGGGCATGG - Intronic
1021527576 7:21606031-21606053 TAGAATCATTTACATGGACATGG + Intronic
1022387600 7:29916105-29916127 TTGATTCATTCCCCTGGAGAAGG - Exonic
1024386866 7:48761966-48761988 TAGAATCCTTGCTTTGGGGAAGG - Intergenic
1024978976 7:55140977-55140999 TAGAATCATTCCCATGGGGAAGG + Intronic
1026415139 7:70171725-70171747 CTGAATCTTTCCCATGGGGAAGG - Intronic
1029050582 7:97682338-97682360 GAGAAACATTCTAATGGGGATGG + Intergenic
1029236062 7:99120047-99120069 CTGACTCATTACCATGGGGATGG - Intronic
1031168943 7:118267393-118267415 AAAAATCTTTCCCATGGGCATGG + Intergenic
1031338699 7:120571409-120571431 TTGAATCATTGCTATGTGGAAGG - Intronic
1032433347 7:131880635-131880657 TAGAACCATTTCCATGGAGCAGG - Intergenic
1033812750 7:145035772-145035794 TTCACTCATTACCATGGGGATGG + Intergenic
1035686535 8:1527520-1527542 CAGATTCATTGCCATGGAGAGGG + Intronic
1036125550 8:6058642-6058664 TAGAATCCACCCCATTGGGAGGG + Intergenic
1037930810 8:22879041-22879063 TAAAATGTTTCCCATGGGGAAGG - Intronic
1039081347 8:33737138-33737160 TATAATCATAGCCTTGGGGAAGG + Intergenic
1039108692 8:34018588-34018610 CTGACTCATTACCATGGGGATGG + Intergenic
1039705145 8:39998937-39998959 TAGAAGCATTAACATGGGGCTGG - Intronic
1039731214 8:40280691-40280713 TGGACTCATTACTATGGGGAGGG - Intergenic
1043286511 8:78538454-78538476 TAGAATAATTCTCAAGGAGAAGG + Intronic
1043597943 8:81905638-81905660 GAGAATCATTACCTTGGGGAAGG + Intergenic
1045385463 8:101667593-101667615 GAGAGTCATGCCCATGGAGAAGG - Exonic
1047103133 8:121702990-121703012 TGAACTCATTACCATGGGGAGGG + Intergenic
1053443689 9:38135854-38135876 TAGAATCATTCCCAGGGTAAAGG + Intergenic
1056632164 9:88302918-88302940 GAGAACCATTCTAATGGGGAAGG - Intergenic
1056812259 9:89774026-89774048 TAGAATCACTCCCATAGGCTAGG - Intergenic
1056860522 9:90176773-90176795 AAGAATCATTACCATGAGGATGG + Intergenic
1187816043 X:23232829-23232851 TGTACTCATTACCATGGGGATGG - Intergenic
1189510315 X:41655504-41655526 GAGAAACATTCAAATGGGGATGG + Intronic
1189516089 X:41714806-41714828 GAGAAACATTCAAATGGGGATGG + Intronic
1190154811 X:47981602-47981624 TAGAATTATTCCAGTGGGGCCGG + Intronic
1190549746 X:51567066-51567088 TACAATCATTTTCAAGGGGATGG + Intergenic
1192707438 X:73541332-73541354 TAGATTCTTCCTCATGGGGAAGG + Intergenic
1194853065 X:98892517-98892539 TAGACTCATTACCATGGGGAGGG - Intergenic
1196375917 X:115032312-115032334 TAGAATCATTCCAAAGAGCATGG + Intergenic
1198334656 X:135654753-135654775 TAGCATCCTGCCCATGTGGAGGG - Intergenic