ID: 1024980569

View in Genome Browser
Species Human (GRCh38)
Location 7:55154320-55154342
Sequence CTGGCTTGCTACCGAGGAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 78}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024980557_1024980569 7 Left 1024980557 7:55154290-55154312 CCCGTCCAGGCACACAGGCGAGG 0: 1
1: 0
2: 0
3: 20
4: 165
Right 1024980569 7:55154320-55154342 CTGGCTTGCTACCGAGGAGCGGG 0: 1
1: 1
2: 0
3: 4
4: 78
1024980555_1024980569 13 Left 1024980555 7:55154284-55154306 CCTGTGCCCGTCCAGGCACACAG 0: 1
1: 0
2: 1
3: 13
4: 212
Right 1024980569 7:55154320-55154342 CTGGCTTGCTACCGAGGAGCGGG 0: 1
1: 1
2: 0
3: 4
4: 78
1024980562_1024980569 2 Left 1024980562 7:55154295-55154317 CCAGGCACACAGGCGAGGGGAGG 0: 1
1: 0
2: 1
3: 31
4: 285
Right 1024980569 7:55154320-55154342 CTGGCTTGCTACCGAGGAGCGGG 0: 1
1: 1
2: 0
3: 4
4: 78
1024980559_1024980569 6 Left 1024980559 7:55154291-55154313 CCGTCCAGGCACACAGGCGAGGG 0: 1
1: 0
2: 1
3: 20
4: 216
Right 1024980569 7:55154320-55154342 CTGGCTTGCTACCGAGGAGCGGG 0: 1
1: 1
2: 0
3: 4
4: 78
1024980554_1024980569 14 Left 1024980554 7:55154283-55154305 CCCTGTGCCCGTCCAGGCACACA 0: 1
1: 0
2: 0
3: 23
4: 140
Right 1024980569 7:55154320-55154342 CTGGCTTGCTACCGAGGAGCGGG 0: 1
1: 1
2: 0
3: 4
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024980569 Original CRISPR CTGGCTTGCTACCGAGGAGC GGG Intronic
900947062 1:5837009-5837031 CTGGCTTTCTGCCCTGGAGCTGG - Intergenic
904461995 1:30685846-30685868 CTGGTTTGCTTGCGAGGAGCAGG - Intergenic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
907758810 1:57337769-57337791 CTGGCCTGTTGCCGATGAGCAGG - Intronic
914826729 1:151142717-151142739 CTGGCTTGCTTCAGGGGAGAGGG - Intronic
918624830 1:186645275-186645297 CTGGCTGGCTCCCGAAGGGCAGG - Intergenic
921222042 1:212980215-212980237 TTGGCTTGCTGCCTATGAGCTGG + Intronic
924568200 1:245215254-245215276 CTGGCTGGTCACCAAGGAGCCGG - Intronic
1067683490 10:48454352-48454374 CTAACTTGCTTCCAAGGAGCTGG + Intronic
1080261959 11:30359118-30359140 CTTCCTTGCTGCCAAGGAGCTGG + Intergenic
1084184410 11:67464146-67464168 CTGCCTTGCCAGCCAGGAGCCGG - Exonic
1084951291 11:72667278-72667300 CTTGCTTGATACTGAGGTGCTGG - Intronic
1097636515 12:62129091-62129113 CTGGTTTTCTACCCAGAAGCAGG + Intronic
1104161301 12:126183386-126183408 ATTGCTTGGAACCGAGGAGCAGG + Intergenic
1105842895 13:24270799-24270821 CTGGGGTGTGACCGAGGAGCCGG - Intronic
1114396569 14:22368487-22368509 CTGGGTAGATACTGAGGAGCAGG - Intergenic
1116983589 14:51196168-51196190 TTGGCTTGTTAGCGAGGAGGGGG - Intergenic
1118380502 14:65214062-65214084 CAGGCTGGCTAACGAGGAGCTGG - Intergenic
1119020566 14:71108658-71108680 CTGGCTGGCTACTGAGGCCCGGG - Exonic
1126110277 15:45171148-45171170 CTGGCTTCCTAACGGGGTGCAGG + Intronic
1131269990 15:90941361-90941383 CTGGCTTGCTCCAGGGGAGAGGG + Intronic
1132099834 15:99015280-99015302 CGGGCTTGCTTCCCAGGCGCGGG + Intergenic
1135509757 16:23072138-23072160 CTGGCTTGCTGCCCGGGAGCCGG + Exonic
1138524212 16:57592618-57592640 CTGGCGTGCTTCTGAGAAGCAGG - Intergenic
1141164874 16:81653616-81653638 CTGGCTTACTACAGGTGAGCAGG - Intronic
1141424691 16:83937140-83937162 CTGTCTTCCCACTGAGGAGCAGG - Intronic
1142177133 16:88650548-88650570 CCAGCTGGCTACCGAGGGGCAGG + Intronic
1144319176 17:14096874-14096896 CTGGCTTTCCACCCAGGAGTGGG + Intronic
1152394408 17:80023694-80023716 CAGGCGGGCCACCGAGGAGCAGG - Intronic
1160328295 18:77969628-77969650 CTGGCTTTCTTCCCAGGGGCAGG + Intergenic
1162495084 19:11019048-11019070 CTCTCTTGCTACGGAGGTGCAGG + Intronic
1162613279 19:11772904-11772926 CTGCCTAGCTCCCGAGTAGCTGG + Intronic
1164633402 19:29776132-29776154 CAGGCCTGCCACCAAGGAGCCGG - Intergenic
1166112052 19:40628418-40628440 CTGGGTTCCTCCCGAGTAGCTGG - Intronic
926010512 2:9402505-9402527 CTGGCTGGTTCCCGAGTAGCTGG - Intronic
929214696 2:39399649-39399671 CTGCCTAGCTACCTAGCAGCAGG + Intronic
932295240 2:70618746-70618768 CTGGCATCCTAAGGAGGAGCAGG + Intronic
936240358 2:110783016-110783038 CTGGCTTAATAATGAGGAGCAGG + Intronic
945879983 2:215315186-215315208 CTGGCTTTCTGTCTAGGAGCTGG - Intronic
946319693 2:218944968-218944990 CTGGCTTGCTAATGAGCATCAGG + Intergenic
947328998 2:229008706-229008728 ATGCCTTGCTACCTAGGAGCAGG - Intronic
1175284403 20:57828458-57828480 CTTGCTTGCTTCAGAGGGGCAGG - Intergenic
1179289606 21:40006962-40006984 CTGGCTTGTTACCGAGGAGCTGG + Intergenic
1179725610 21:43339846-43339868 CTGGCTTGGAACCGAGGAAGAGG + Intergenic
1185084834 22:48735197-48735219 CTGGGATCCTACCAAGGAGCTGG + Intronic
950450075 3:13060499-13060521 CTGGCTTTCCACCGATGGGCGGG + Intronic
951538827 3:23763606-23763628 CTCGCTTGATACAGAGCAGCAGG - Intergenic
952756623 3:36874545-36874567 CTTGCTTGTTACCAAGGAGAGGG - Intronic
953369634 3:42376385-42376407 GTGGCTTCCTACCCAGGAACTGG - Intergenic
953881573 3:46693802-46693824 CGGGCGGGCCACCGAGGAGCTGG + Intergenic
954900866 3:54018419-54018441 CTGGCTTAATACCGAGGTGATGG + Intergenic
958648313 3:96902000-96902022 CTGGCTTACTACAGAGGATGGGG + Intronic
960216948 3:115051886-115051908 ATGGCTTACTATGGAGGAGCAGG + Intronic
960934860 3:122892561-122892583 CGGGCTTGCTGCGGAGGAGAAGG - Intergenic
965371753 3:167871310-167871332 CTGCCTTTCTATCTAGGAGCTGG - Intergenic
966743567 3:183254578-183254600 CTGTCCCGCCACCGAGGAGCCGG - Intronic
967851603 3:194086720-194086742 CTGCTTTGCTACCGTGGTGCCGG + Intergenic
967880620 3:194298811-194298833 CCGGGGTGCCACCGAGGAGCTGG - Intergenic
972570783 4:40308777-40308799 CTTGCTTTCTCCCGAGGAGAAGG - Intergenic
980628825 4:135408243-135408265 CTGGCCTGCTAGGGAGGGGCAGG + Intergenic
982189296 4:152837278-152837300 CTGGCTAGATACCCAGGAGTGGG + Intronic
983546567 4:168970979-168971001 CTGGGTAGATACCCAGGAGCGGG + Intronic
993657144 5:90592103-90592125 CTGGGTTGATACCCAGGAGTGGG - Intronic
999367627 5:151033436-151033458 CTGGGCTGCTACCCAGGGGCAGG - Intronic
1002593234 5:180305270-180305292 GTGGCTGGCTAGGGAGGAGCAGG - Intronic
1006614643 6:35318158-35318180 CTGGATGGCTGCCGAAGAGCGGG - Exonic
1014842385 6:126235752-126235774 CTGGCTTAATACCTAGGAGATGG + Intergenic
1016531394 6:145061393-145061415 CTGGGTTTCTACCCAGGGGCCGG + Intergenic
1018896121 6:168018776-168018798 CTGACGTCCTTCCGAGGAGCAGG - Intronic
1020142967 7:5622497-5622519 CTGCCTTGCTACCCAGGGGTCGG + Intronic
1021879298 7:25078080-25078102 CTGGCTAGGTAGGGAGGAGCAGG + Intergenic
1023874428 7:44278958-44278980 CAGGGATGCTACCCAGGAGCAGG + Intronic
1024963483 7:55002696-55002718 CTGGCTTGCAGCTGTGGAGCAGG - Intergenic
1024972645 7:55084897-55084919 CTGCCCTGCTACCGAGAACCTGG - Intronic
1024980569 7:55154320-55154342 CTGGCTTGCTACCGAGGAGCGGG + Intronic
1034551698 7:151824773-151824795 CTGGCTTGCTGCTGAGGACGTGG + Intronic
1038732982 8:30144245-30144267 CTGCCTCCCTCCCGAGGAGCTGG + Intronic
1041402187 8:57457519-57457541 CTGGCCTGCTAGGGAGGGGCTGG + Intergenic
1045538803 8:103061311-103061333 CTGGCTGGCTGACGAGGAGTAGG + Intronic
1049335063 8:142079902-142079924 CAGGCTTGCTCCAGAGCAGCTGG + Intergenic
1201791768 Y:17848754-17848776 ATGGCTTGTAACAGAGGAGCCGG + Intergenic
1201809786 Y:18057235-18057257 ATGGCTTGTAACAGAGGAGCCGG - Intergenic
1202353374 Y:24018409-24018431 ATGGCTTGTAACGGAGGAGCCGG + Intergenic
1202517405 Y:25651706-25651728 ATGGCTTGTAACGGAGGAGCCGG - Intergenic