ID: 1024985856

View in Genome Browser
Species Human (GRCh38)
Location 7:55192597-55192619
Sequence GACTGAAATCCCCTGTTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024985851_1024985856 1 Left 1024985851 7:55192573-55192595 CCAGAGCAGCCCTGAACTCCGTC 0: 1
1: 0
2: 0
3: 14
4: 139
Right 1024985856 7:55192597-55192619 GACTGAAATCCCCTGTTGCCGGG 0: 1
1: 0
2: 1
3: 9
4: 128
1024985852_1024985856 -8 Left 1024985852 7:55192582-55192604 CCCTGAACTCCGTCAGACTGAAA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1024985856 7:55192597-55192619 GACTGAAATCCCCTGTTGCCGGG 0: 1
1: 0
2: 1
3: 9
4: 128
1024985853_1024985856 -9 Left 1024985853 7:55192583-55192605 CCTGAACTCCGTCAGACTGAAAT 0: 1
1: 0
2: 0
3: 7
4: 60
Right 1024985856 7:55192597-55192619 GACTGAAATCCCCTGTTGCCGGG 0: 1
1: 0
2: 1
3: 9
4: 128
1024985850_1024985856 5 Left 1024985850 7:55192569-55192591 CCTACCAGAGCAGCCCTGAACTC 0: 1
1: 0
2: 1
3: 14
4: 242
Right 1024985856 7:55192597-55192619 GACTGAAATCCCCTGTTGCCGGG 0: 1
1: 0
2: 1
3: 9
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024985856 Original CRISPR GACTGAAATCCCCTGTTGCC GGG Intronic
900555192 1:3276798-3276820 GTCTGACATCTCCTGTTGCCTGG + Intronic
900876977 1:5349825-5349847 CACTGAAAGCCCCTGATGCTGGG + Intergenic
901454550 1:9355568-9355590 GAATGAAATCCCCCGTTCCCTGG - Intronic
903636748 1:24824238-24824260 AACTGAAATCTCCTGTCCCCAGG - Intronic
904224357 1:29002928-29002950 GACTGGAATCTCCTGTTTTCAGG + Intronic
904301284 1:29556472-29556494 GAATCAAACCTCCTGTTGCCTGG + Intergenic
904318560 1:29681730-29681752 GACTGAATGTCACTGTTGCCCGG + Intergenic
904438928 1:30517253-30517275 GACTGAATGTCACTGTTGCCCGG - Intergenic
905608931 1:39331553-39331575 GACTGAAACCTCCAGTTGCCAGG - Intronic
905995619 1:42378912-42378934 AACTGAAATCTCCTGTTTTCAGG - Intergenic
906138982 1:43522079-43522101 GCCTGAAATCCCCCCTTGCTTGG + Intergenic
907667952 1:56449846-56449868 GACTGTAACCCCCTGTGGGCAGG - Intergenic
910171476 1:84382330-84382352 GACTGGAATCTCCTGTTTTCAGG - Intronic
914880129 1:151540509-151540531 GGCTGACATCACCTGGTGCCCGG + Intronic
917269144 1:173254454-173254476 GACTGGAATCTCCTGTTTTCAGG + Intergenic
919835331 1:201569319-201569341 GCATGAACTCCCCTGATGCCAGG + Intergenic
922561584 1:226573435-226573457 GCCTGAAATCCACTGTGCCCTGG - Intronic
923078887 1:230635257-230635279 GACTGGAATCTCCTGTTTTCAGG - Intergenic
923942534 1:238844188-238844210 GTCTGAAAACCCCTGTTGGAGGG + Intergenic
1063017671 10:2094803-2094825 CATTGCAATCCCCTGTTGACAGG + Intergenic
1065162266 10:22934927-22934949 CACTGAAGTCCCCTGAGGCCTGG + Intronic
1073462259 10:103672716-103672738 GACTGAAATGGCCTAATGCCTGG + Intronic
1074184517 10:111088988-111089010 AACTGAGATCTCCTGGTGCCAGG + Intergenic
1074838805 10:117327437-117327459 GACTGGAATCACCTGTTTTCAGG - Intronic
1076618759 10:131773579-131773601 GCCTGGCATCCCCTGCTGCCAGG + Intergenic
1077550009 11:3196019-3196041 GACAGTAAACTCCTGTTGCCTGG + Intergenic
1078253911 11:9641032-9641054 GAATGAAATAACCTGTTGCCTGG - Intergenic
1078655881 11:13238616-13238638 GACAAATATCCCCTGTTGCCCGG - Intergenic
1078707453 11:13758874-13758896 GACTGGAATCTCCTGTTTTCAGG + Intergenic
1084267244 11:68011377-68011399 GACTGGAATCTCCTGCTTCCCGG + Intronic
1084964876 11:72739302-72739324 GACAGGAATCTCCTGGTGCCAGG - Intronic
1088766032 11:112979605-112979627 GACTGGAATCTCCTGTTTTCAGG + Intronic
1091284308 11:134399561-134399583 CACTGACCTCCCCTTTTGCCAGG + Intronic
1094054698 12:26256848-26256870 GTCTGAAAACCCCTGTTGGAGGG - Intronic
1096081193 12:48833674-48833696 GCATGAAATCACTTGTTGCCTGG + Intronic
1096287865 12:50315859-50315881 GACTGCAATCCCCTCTTCACAGG + Intergenic
1096475846 12:51908230-51908252 GACTGGGATCCCCTTTGGCCTGG - Intronic
1103208714 12:119151006-119151028 GACTGAAATCCCCTGCAGGTGGG - Exonic
1103891057 12:124239473-124239495 GCCTGGAGTCCCCTGTTCCCGGG - Intronic
1104765638 12:131328296-131328318 GACTGACAGCCCCTGCTCCCGGG - Intergenic
1104813683 12:131633756-131633778 GACTGAGAGCCCCTGCTCCCGGG + Intergenic
1107966112 13:45599631-45599653 GACTGGAATCTCCTGTTTTCAGG + Intronic
1110060438 13:71032918-71032940 GCCTGACCTCCCCTGTTGTCAGG - Intergenic
1112281031 13:98063463-98063485 GACTGAAATCTCTTGTTTTCAGG + Intergenic
1121303912 14:92893256-92893278 GACTGAAATTTCCTGTTTTCAGG - Intergenic
1122595738 14:102889745-102889767 AACTGAAACACCCTGTTGCATGG + Intronic
1127263568 15:57343752-57343774 GACTGAAGACCCCTGTGGGCAGG + Intergenic
1130685292 15:86031875-86031897 GATTGCATTCCCCTGCTGCCAGG + Intergenic
1131658063 15:94482943-94482965 CACTGAAATGGCTTGTTGCCAGG - Exonic
1132940852 16:2507392-2507414 AACTGAAAGCCTCTGTTTCCCGG + Intronic
1133132193 16:3683825-3683847 GACAGAAATCATCTGTTGCCAGG + Intronic
1135271865 16:21076614-21076636 GACTGGAATCTCCTGTTTTCAGG - Intronic
1136177677 16:28529281-28529303 GACTGGAATCTCCTGTTTTCAGG + Intergenic
1137061602 16:35795542-35795564 CAATGAAAGCCACTGTTGCCTGG - Intergenic
1138514227 16:57527090-57527112 GGCTGAAGTCCCCTCTTCCCTGG - Intronic
1138637021 16:58348105-58348127 GACTGGAATCCCATGTTTTCAGG + Intronic
1139601974 16:67992749-67992771 TACTGAGATCCCCTGAGGCCCGG + Intronic
1139913608 16:70414416-70414438 GACTGAAGGCCCGTGTTACCTGG - Intronic
1142911646 17:3098223-3098245 GTCTGACATCCCCTGTTGGAGGG - Intergenic
1143748367 17:9010247-9010269 GACTGAAGTCCCCTGTGTCTTGG + Intergenic
1146458098 17:33022754-33022776 GACTGAAAGCCCCTGAGGGCAGG - Intronic
1148430195 17:47636515-47636537 TACTGGAATATCCTGTTGCCTGG + Intergenic
1151223211 17:72629169-72629191 GAATGAAATACTCTGCTGCCAGG - Intergenic
1151339781 17:73463537-73463559 GAGAGAAATCACCTGGTGCCGGG - Intronic
1152117872 17:78399724-78399746 GACTGGAAGCCACTGTTGACAGG + Intronic
1152221438 17:79070374-79070396 GACTGGAATCTCCTGTTTTCAGG + Intergenic
1153844664 18:9038449-9038471 GACTGGAATCTCCTGTTCTCAGG + Intergenic
1155735200 18:29213075-29213097 AAATGAAATACCCTCTTGCCTGG + Intergenic
1161822143 19:6536237-6536259 GAATTGAATCACCTGTTGCCAGG - Intergenic
925250667 2:2434522-2434544 AACAGAAATCCACTGTTTCCTGG + Intergenic
925781586 2:7386912-7386934 CACTGAAATCCACTGGGGCCAGG - Intergenic
926943196 2:18159704-18159726 GATTGTAATCCCCTGACGCCTGG - Intronic
928108634 2:28489126-28489148 AGCTGAAATCCCCTGTGTCCTGG - Intronic
930608539 2:53517009-53517031 GACTGAAATTCCCTCCGGCCTGG - Intergenic
932199886 2:69816173-69816195 AACCGAAATCACCTGTTGCATGG + Exonic
937095072 2:119229905-119229927 GAGTGAAAGCCCCTGTGGGCAGG - Intronic
939965034 2:148602011-148602033 GAATGAAATTGCCTGTTGACTGG + Intergenic
946483430 2:220078225-220078247 GACAGAAAGCCCCTCTGGCCTGG - Intergenic
948589481 2:239039923-239039945 GACAGAAACCCCCTGTGGCTGGG - Intergenic
948755316 2:240156158-240156180 GACTGGAATCTCCTGTTTTCAGG - Intergenic
1168988572 20:2073296-2073318 CACTGAAATCCCCGGCTCCCAGG - Intergenic
1169201104 20:3710618-3710640 CCCTGACATCCCCTGTGGCCAGG - Intergenic
1172957351 20:38770684-38770706 CACTTAAATCCCCTGAAGCCAGG + Intronic
1173968132 20:47129427-47129449 GCCTGAAATCCCCTCTTCCCAGG - Intronic
1179533285 21:42034589-42034611 CACTGAAATCCCCTCTTGCTTGG + Intergenic
1180695084 22:17746816-17746838 GGCTGGAATCCCATGTTGCCCGG - Intronic
1181784927 22:25220135-25220157 CATTGAAATCACCTGTTGCTGGG - Intronic
1181962211 22:26630359-26630381 TACTGAAATCCTCGGTAGCCCGG - Exonic
1184277572 22:43418890-43418912 GCCTGAAAGCCCATGGTGCCTGG - Intronic
1184834378 22:47012424-47012446 GACAATAATCCCCTGGTGCCTGG - Intronic
1184982476 22:48104240-48104262 CACACAACTCCCCTGTTGCCTGG + Intergenic
954777789 3:53035670-53035692 CACTGAAACCCCCACTTGCCAGG + Intronic
955015319 3:55064231-55064253 GATTGAAATCCCTTGTAGACTGG - Intronic
959880519 3:111440032-111440054 GACTGAAATCCCTTCTGGTCAGG + Intronic
964831291 3:160886405-160886427 GTCTGAAAACCCCTGTTGGAGGG - Intronic
968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG + Intronic
972324542 4:38002941-38002963 GACTGGAATCTCCTGTTTTCAGG - Intronic
974991209 4:69093155-69093177 GACTGGAGTCCCCTGTTGGGAGG + Intronic
976257609 4:83115656-83115678 GACTGAAATCTCCTGTTTTTTGG + Intronic
976769411 4:88634705-88634727 GTCTGACAACCCCTGTTGGCGGG - Intronic
978473394 4:109097103-109097125 GACTGAAATCCCCTGTTTGCAGG + Intronic
982149014 4:152431465-152431487 GACTGGAATCTCCTGTTCTCAGG + Intronic
983923409 4:173371134-173371156 GACAGAAATCCCCTCTCTCCTGG - Exonic
990609871 5:57446111-57446133 GACTGCAAGCCCCTGATGACAGG - Intergenic
992900063 5:81285894-81285916 AACTGAAATTCCCTCTTGCAGGG - Intergenic
995856823 5:116601190-116601212 GGCTGAAATCCTGTGTTGACGGG + Intergenic
1001406180 5:171479355-171479377 GCCTGAGAGCCCTTGTTGCCAGG + Intergenic
1002293823 5:178217516-178217538 GGCTTAAATCTGCTGTTGCCAGG - Intronic
1002329060 5:178429109-178429131 CGCTGAAATGCCCTGGTGCCTGG - Intronic
1003028370 6:2578961-2578983 GACTGGAATCTCCTGTTTTCAGG + Intergenic
1003744210 6:8981317-8981339 GGCTGAAAGGCACTGTTGCCAGG + Intergenic
1004819625 6:19353187-19353209 AACTGGAATCCCATGCTGCCTGG - Intergenic
1005041949 6:21608006-21608028 GACTTAAATCTCATCTTGCCTGG - Intergenic
1006190050 6:32202049-32202071 GCCTGAAATCCACTGGAGCCAGG - Intronic
1006968484 6:38014715-38014737 GACTGAAATCCTCTTTCTCCTGG + Intronic
1007995774 6:46306244-46306266 CACTGAAATCCCCTATTCCTTGG + Intronic
1013796395 6:113894000-113894022 GACTGGAATCTCCTGTTTTCAGG - Intergenic
1015754482 6:136593825-136593847 AAAGGAAATCCACTGTTGCCTGG + Intronic
1016458162 6:144253468-144253490 GACTGGAATCTCCTGTTTTCAGG - Intergenic
1017315895 6:153031015-153031037 GAATGAGATCCCCTTTTTCCAGG - Intronic
1017808937 6:157970097-157970119 GACTGGAATCTCCTGTTTTCAGG + Intergenic
1024985856 7:55192597-55192619 GACTGAAATCCCCTGTTGCCGGG + Intronic
1026529438 7:71184580-71184602 GACTGAAATCGCCAGCTCCCTGG + Intronic
1031204703 7:118741856-118741878 GAATAAAACCCCCTGTTTCCTGG - Intergenic
1031789244 7:126079343-126079365 GGCTTAAATCTCCTGCTGCCTGG + Intergenic
1034833049 7:154326519-154326541 GACTAATTTCCCTTGTTGCCAGG + Intronic
1035283116 7:157789543-157789565 GGCTGAATTCCCTTGTTGTCAGG - Intronic
1035393483 7:158520972-158520994 GGCTGAAATCTCCTGTTCCTTGG - Intronic
1036648935 8:10629843-10629865 GACTGAGATCCCATTCTGCCTGG + Intronic
1048523496 8:135179281-135179303 AACTGAAATACCCAGTTACCTGG + Intergenic
1049297396 8:141850056-141850078 GGCTGTAATCCCCACTTGCCAGG - Intergenic
1050248243 9:3714211-3714233 GACTCCAATCCCTTGTTCCCAGG + Intergenic
1051247015 9:15122329-15122351 GACTGGAATCTCCTGTTTTCAGG - Intergenic
1059596364 9:115724533-115724555 GTCTGACATCCCCTGTTGGAGGG - Intergenic
1060321043 9:122561779-122561801 GTCTGACAACCCCTGTTGCAGGG + Intergenic
1061588348 9:131582913-131582935 GCCTGAAGTCCCCTGTGACCAGG - Intronic
1062446406 9:136597175-136597197 CACCGACATCCCCTGATGCCAGG - Intergenic
1186741645 X:12524262-12524284 GACTGGAATCTCCTGTTTTCAGG + Intronic
1195153491 X:102097765-102097787 GTCTGGAATCCCCTGTTGGGAGG - Intergenic