ID: 1024986852

View in Genome Browser
Species Human (GRCh38)
Location 7:55201653-55201675
Sequence GAGGCACACCACCTGCATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024986847_1024986852 -2 Left 1024986847 7:55201632-55201654 CCTTCACAATATACCCTCCATGA 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1024986852 7:55201653-55201675 GAGGCACACCACCTGCATTCAGG 0: 1
1: 0
2: 0
3: 19
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024986852 Original CRISPR GAGGCACACCACCTGCATTC AGG Intronic
900334171 1:2153274-2153296 GAGAGACGCAACCTGCATTCAGG - Intronic
900566746 1:3336133-3336155 TAGGCCCAGCCCCTGCATTCAGG + Intronic
900694033 1:3999322-3999344 CAGGCAGATCACCTGAATTCAGG - Intergenic
900948796 1:5845990-5846012 GAGCCTGACCACCTGCATCCGGG + Intergenic
901389530 1:8934997-8935019 CAGGCAGATCACCTGCAGTCAGG - Intergenic
902743640 1:18458261-18458283 GAGGCACACACCCTCCCTTCTGG + Intergenic
902834691 1:19038944-19038966 GAGGCACAGCCCTTGCCTTCAGG - Intergenic
902857026 1:19215070-19215092 CAGGCAGACCACCTGAAGTCAGG + Intergenic
903563652 1:24247926-24247948 TGGGCAGATCACCTGCATTCAGG + Intergenic
906195856 1:43930466-43930488 GTGTCCCACCACCTGCATGCTGG - Exonic
910800257 1:91138079-91138101 CATGCACACCACCAGCATGCGGG - Intergenic
912915007 1:113806106-113806128 GAGGCACATCACCTGAGGTCAGG + Intronic
915176621 1:154020887-154020909 CAGGCAGACCACCTGAAGTCAGG - Intronic
916800329 1:168209909-168209931 CAGGCAGATCACCTGAATTCAGG + Intergenic
916849928 1:168693361-168693383 TAGGCACAGTTCCTGCATTCTGG - Intergenic
917945963 1:179971254-179971276 CAGGCAGATCACCTGCAGTCAGG - Intronic
921504234 1:215947269-215947291 GTGGCAGACCACCTGAAGTCAGG - Intronic
922469402 1:225866687-225866709 GAGGGAAACCACCTGCCATCAGG + Intronic
924030675 1:239882133-239882155 CAGGCAGACCACCTGAGTTCAGG - Intronic
924135050 1:240957107-240957129 GAGGCAGACCACCCTCAATCTGG + Intronic
924444974 1:244120578-244120600 GAGGAAAAGCATCTGCATTCAGG + Intergenic
924603664 1:245513751-245513773 GAGGAACAGCACCTGCATTAGGG + Intronic
1063535353 10:6877479-6877501 GAGACAAACTGCCTGCATTCTGG - Intergenic
1065706419 10:28475242-28475264 CAGGCAGACCACCTGAAGTCAGG - Intergenic
1066048007 10:31611329-31611351 GAAGCAATCCACCTTCATTCGGG - Intergenic
1066090305 10:32012243-32012265 GAGGCAGATCACCTGCGGTCAGG + Intronic
1066337559 10:34494549-34494571 GAGGCACTGGACCTGCTTTCTGG - Intronic
1066602348 10:37123344-37123366 GAGGCAGATCACCTGAAGTCAGG - Intergenic
1067168112 10:43881671-43881693 GAGGCTCACCAAATGCTTTCTGG - Intergenic
1069468328 10:68662100-68662122 CAGGCAGACCACCTGAGTTCAGG - Intronic
1070146705 10:73779334-73779356 CAGGCAGACCACCTGAAGTCGGG + Intronic
1070351547 10:75597471-75597493 GAGGCACAGCCCCTGCAATCTGG + Intronic
1070379078 10:75863485-75863507 GAGCCACACTACCTGGACTCAGG + Intronic
1075323464 10:121511030-121511052 CAGGCAGATCACCTGCAGTCAGG - Intronic
1076035072 10:127193290-127193312 GAGGCAAACCACCGTCATTCTGG - Intronic
1077316687 11:1922486-1922508 ACGGCACACGGCCTGCATTCTGG + Intronic
1078508712 11:11969682-11969704 GGGGCTCCACACCTGCATTCAGG - Intronic
1081614876 11:44584901-44584923 CAGGCACTCCACCTGCAAGCTGG - Intronic
1082857994 11:57826689-57826711 GAGGCAGATCACCTGAAGTCAGG - Intergenic
1084050271 11:66594869-66594891 CAGGCACATCCCCTGCACTCAGG + Intronic
1085261139 11:75205326-75205348 GAGGCCCAACACCTGCCTTAGGG + Exonic
1085327528 11:75618625-75618647 GAGGGACTCCCCCTGCACTCAGG - Intronic
1087346823 11:96982149-96982171 CAGGCACCCCACCTGAATTAGGG + Intergenic
1091240550 11:134049367-134049389 GAGGCACACGACAGGCAGTCGGG + Intergenic
1091278541 11:134368953-134368975 CAGGCACACCACCTCCCTTGAGG - Intronic
1095739178 12:45588367-45588389 GAGTTACACCACCAGCTTTCTGG + Intergenic
1100642216 12:96492763-96492785 CAGGCAGATCACCTGCAGTCAGG + Intronic
1109953829 13:69539227-69539249 GAGTCACACCAGCTGAATTAAGG - Intergenic
1114389525 14:22291927-22291949 CAGGCAGATCACCTGCAGTCAGG + Intergenic
1114396089 14:22363029-22363051 GAGGCACCCCACTTTCATGCTGG + Intergenic
1118256871 14:64212984-64213006 GCGGCTCACCTCCTGCACTCCGG + Exonic
1118272200 14:64353849-64353871 CAGGCAGATCACCTGCAGTCAGG + Intergenic
1118458392 14:65965864-65965886 GAGGGTCACCACCTGCAGTTAGG + Intronic
1119233844 14:73003283-73003305 GAGGCAGATCACCTGAAGTCAGG - Intronic
1122607284 14:102955193-102955215 GGGGCAGACCACCTGAAGTCAGG + Intronic
1127416986 15:58767881-58767903 CAGGCAGATCACCTGCAGTCGGG - Intergenic
1127783464 15:62335856-62335878 GAGGCACTGCACCTGGCTTCAGG - Intergenic
1128539525 15:68516847-68516869 GAGTCAGACCACCTGACTTCTGG + Intergenic
1129121382 15:73398967-73398989 GAAGCCCAGCAACTGCATTCCGG - Intergenic
1131894274 15:97008560-97008582 CAGCCACACCACCTGTCTTCTGG + Intergenic
1135508594 16:23060842-23060864 GAGGCTAACCACCTGCAGGCTGG + Intergenic
1136013466 16:27379871-27379893 CAGGCACATCACCTGAGTTCAGG - Intergenic
1136187883 16:28598792-28598814 CAGGCAGACCACCTGAAGTCGGG + Intergenic
1136190355 16:28611786-28611808 CAGGCAGACCACCTGAAGTCGGG + Intronic
1136279333 16:29198828-29198850 GGGGCACACCACCTGCCGCCTGG - Intergenic
1137014982 16:35365644-35365666 GAGTCACATCACCTGGATGCTGG + Intergenic
1137035403 16:35565580-35565602 AAGGCACATCACCTGGATGCTGG + Intergenic
1137455730 16:48616413-48616435 CAGGCCCACCACATGCATTCTGG - Intronic
1138168013 16:54820690-54820712 GAGGCCCAGCATCTGCTTTCTGG + Intergenic
1140787172 16:78353763-78353785 GAGCCACATCACCTGCAGGCAGG + Intronic
1141327766 16:83078547-83078569 GAGGCACATCTCCTGCTGTCCGG + Intronic
1142277813 16:89132198-89132220 GAGGCTCATCACCTGCCATCTGG - Intronic
1143272077 17:5683314-5683336 GAGACACACCATCTGCCTCCTGG + Intergenic
1144803705 17:17949695-17949717 GGGACACACCACCAGCCTTCTGG - Intronic
1144855464 17:18264964-18264986 GAGGCAGCCCAGCTGCACTCAGG - Exonic
1144882706 17:18438838-18438860 CAGGCACCCCACCTGCAGGCCGG - Intergenic
1145149527 17:20505548-20505570 CAGGCACCCCACCTGCAGGCCGG + Intergenic
1146415230 17:32625756-32625778 CAGGCAGATCACCTGCACTCAGG - Intronic
1146725148 17:35150196-35150218 GAGACTCAACACCAGCATTCAGG + Exonic
1147578058 17:41613810-41613832 CAGGCACCCCACCTGCAGGCTGG + Intronic
1147592738 17:41695359-41695381 CAGGCAGACCCCCTGCACTCAGG + Intergenic
1148028830 17:44606309-44606331 GAGGCTCAGCTCCTGCCTTCAGG - Intergenic
1148244558 17:46021924-46021946 GGGGCACACCACCAGCCTCCTGG + Intronic
1148360296 17:47006382-47006404 GAGGCAGATCACCTGAAGTCAGG + Intronic
1148443974 17:47726759-47726781 GAGGCACAGAACCTACACTCAGG + Intergenic
1148701110 17:49587537-49587559 GAGCCGCAGCACCTGCATGCAGG - Intergenic
1150541022 17:66099274-66099296 CAGGCAGATCACCTGCAGTCAGG + Intronic
1150811178 17:68358459-68358481 CAGGCAGATCACCTGAATTCAGG + Intronic
1152191710 17:78892124-78892146 GAGGCACAGCACCTGCACGTCGG - Exonic
1152370052 17:79881344-79881366 GAGGCAGATCACCTGAGTTCAGG - Intergenic
1153701568 18:7699635-7699657 CAGGCAGATCACCTGCAGTCAGG - Intronic
1155069643 18:22303064-22303086 GAGGCAGGCCACCTTTATTCTGG + Intergenic
1158474519 18:57768156-57768178 CAGGCAGATCACCTGCAGTCAGG + Intronic
1159481985 18:69001528-69001550 GAAGCACACTACCAGGATTCTGG - Intronic
1159580830 18:70232882-70232904 GAGCCACCACACCTGGATTCTGG - Intergenic
1160001602 18:75029541-75029563 CACGCTCACCACCTTCATTCAGG + Intronic
1161312831 19:3604302-3604324 GAGTCACACGACCTGCAAGCCGG - Intronic
1162303911 19:9859912-9859934 CAGGCAAATCACCTGCAGTCAGG + Intronic
1162728271 19:12702593-12702615 GAGGCAGATCACCTGAAGTCAGG - Intronic
1163718877 19:18888601-18888623 GAGGCAGATCACCTGAAGTCGGG + Intronic
1163881933 19:19931416-19931438 CAGGCAGATCACCTGAATTCAGG - Intronic
1164083261 19:21878908-21878930 GAGTCACATTACCTGCATGCTGG - Intergenic
1164097714 19:22026658-22026680 GGGTCACATCACCTGCAATCTGG + Intergenic
1164181200 19:22820272-22820294 GAGACACACCACCTGGTTTGGGG - Intergenic
1164181653 19:22824311-22824333 GAGTCACACCAACTGGGTTCTGG - Intergenic
1164233063 19:23308090-23308112 GAGGCACATCACCTGGGTTCTGG - Intronic
1164233665 19:23313476-23313498 GAGACACATCACCTGGCTTCCGG - Intronic
1164234036 19:23316577-23316599 GAGTCACATCACCTGTATTCTGG - Intronic
1164242901 19:23405988-23406010 GACTCACAGCACCTGCATTTTGG + Intergenic
1164294648 19:23899121-23899143 GAGTCACATCACCTGGATGCTGG - Intergenic
1164303513 19:23982897-23982919 GAGGCACATCACCTGGTTTCTGG + Intergenic
1164311685 19:24051516-24051538 GAGTCACATCACCCGGATTCTGG - Intronic
1164527519 19:29022859-29022881 GAGCCCCACCACATCCATTCTGG + Intergenic
1165439789 19:35818614-35818636 GAGGCACACAACCTGGATTGGGG + Intergenic
1165753091 19:38273428-38273450 GAGGCAGATCACCTGAAGTCAGG - Intronic
1165998729 19:39864495-39864517 GAGGCAGATCACCTGAATCCAGG - Intronic
1167004764 19:46768264-46768286 GAGGCAAATCACCTGCGGTCGGG + Intronic
929735314 2:44541899-44541921 CAGGCAGATCACCTGCAGTCAGG + Intronic
931343842 2:61427933-61427955 GAGGCAGATCACCTGAAGTCAGG + Intronic
933156254 2:78979084-78979106 CAGGCAGATCACCTGCAGTCAGG - Intergenic
933712707 2:85339203-85339225 CAGGCAGACCACCTGAAGTCGGG - Intergenic
935006844 2:99087277-99087299 CAGGCAGATCACCTGCAGTCAGG + Intronic
935784931 2:106540490-106540512 CAGGCAAACCCCCTGCTTTCAGG + Intergenic
937958127 2:127434710-127434732 GATGCAGCCCACCTGCATTATGG + Intergenic
938705113 2:133916949-133916971 GAAGCACACCAGCAGCATTCTGG + Intergenic
941708372 2:168684311-168684333 AAGGGACACCTCTTGCATTCTGG + Intronic
941953841 2:171184413-171184435 CAGGCAGATCACCTGAATTCGGG + Intronic
944367972 2:198946888-198946910 GAGTCATAGCATCTGCATTCTGG + Intergenic
944745476 2:202651287-202651309 TAGGCAGATCACCTGCAATCAGG - Intronic
944768343 2:202887249-202887271 CGGGCACATCACCTGCAGTCAGG - Intronic
945144302 2:206720923-206720945 GAGGCAGATCACCTGAAGTCAGG + Intergenic
945784335 2:214214395-214214417 GAGGCAGATCACCTGAAGTCAGG - Intronic
947032687 2:225815894-225815916 GAGTCACACCATCTGACTTCAGG - Intergenic
948732803 2:239977871-239977893 GAGGCACAGAACCTACATCCAGG - Intronic
1168870384 20:1122525-1122547 CAGGCAGATCACTTGCATTCAGG - Intronic
1172962490 20:38808312-38808334 CAAGCACAGCACCTGAATTCAGG - Intronic
1173461873 20:43249342-43249364 GAGGCAGACCACCTACCTCCTGG - Intergenic
1173950958 20:46993008-46993030 GAGTCACAGGACCTGCACTCAGG + Intronic
1176071325 20:63227999-63228021 GAGGCAGACCACCTGAGGTCAGG - Intergenic
1176214868 20:63943216-63943238 GAGGCCCTCCACCTGCAACCAGG + Intronic
1176337976 21:5616535-5616557 GAGACACATCACCTGCATGCTGG - Intergenic
1176339384 21:5679608-5679630 GAGACACATCACCTGCATGCTGG - Intergenic
1176471638 21:7111761-7111783 GAGACACATCACCTGCATGCTGG - Intergenic
1176495199 21:7493539-7493561 GAGACACATCACCTGCATGCTGG - Intergenic
1176505443 21:7644848-7644870 GAGACACATCACCTGCATGCTGG + Intergenic
1178545066 21:33486287-33486309 GGGACTCACCACCTGCATTTTGG - Intronic
1180560942 22:16613818-16613840 CAGCCACACCTCCTGCATACAGG + Intergenic
1182692783 22:32175650-32175672 GAGACACTCCACCTGCTCTCCGG - Intergenic
1182740485 22:32563894-32563916 GAGGCAGACCACCTGAGGTCAGG - Intronic
1183094657 22:35544826-35544848 GAATAACACCACCTGCTTTCTGG + Intronic
1183553779 22:38509082-38509104 CAGGCAGATCACCTGAATTCAGG - Intergenic
1185376514 22:50484940-50484962 CAGGCACATCACCTGAGTTCAGG + Exonic
950082659 3:10234646-10234668 GAGGCTCACCTCCTGCAGGCTGG - Exonic
955689371 3:61575836-61575858 AAGGCACATCACCTGAGTTCAGG - Intronic
957450515 3:80376014-80376036 GAGGCAGACCACCCTCAGTCTGG - Intergenic
958659663 3:97049895-97049917 TAGGCCCACCACCAGCATTGGGG + Intronic
959573713 3:107911538-107911560 GAGACAGACCACAGGCATTCTGG - Intergenic
960490550 3:118312482-118312504 CAGACACACCAACTGCAGTCAGG + Intergenic
961229306 3:125287948-125287970 AAGGCCCACCACCTCCATGCAGG + Intronic
965118498 3:164521372-164521394 CAGGCACACCATCTGCAGCCAGG + Intergenic
965155567 3:165048842-165048864 CAGGCACAACACCTGAAGTCAGG - Intronic
965573969 3:170199057-170199079 CAGGCAGATCACCTGCAGTCAGG - Intergenic
969263585 4:6049545-6049567 GTGTGACTCCACCTGCATTCTGG + Intronic
969570489 4:8005428-8005450 AAGGCACGCCACCTGCACCCCGG - Intronic
972452173 4:39212562-39212584 GAGGCACATCACCTGAGGTCAGG + Intronic
973984727 4:56339521-56339543 CAGGCAGATCACCTGCAGTCAGG + Intronic
974540190 4:63224068-63224090 CAGGCAGATCACCTGCAGTCAGG - Intergenic
976544942 4:86324177-86324199 CAGGCAGATCACCTGCAGTCAGG + Intronic
980433487 4:132737301-132737323 GAGGGAAACCACCTGATTTCAGG + Intergenic
982101270 4:151970595-151970617 GTGGTACACCACCTCCATTGTGG + Intergenic
984766700 4:183405465-183405487 CAGGGACAGCTCCTGCATTCTGG - Intergenic
988475722 5:31583499-31583521 CAGGCAGACCACCTGAAGTCAGG + Intergenic
989055514 5:37362513-37362535 CAGGCAGATCACCTGCAGTCGGG - Intronic
990597348 5:57324822-57324844 CAGGCCCACCTCCTGCTTTCTGG - Intergenic
996519795 5:124414022-124414044 GAGGCAGACGTCCTGCAGTCAGG - Intergenic
999315171 5:150579028-150579050 GAGGCACATCAGCTGCAGTGGGG + Intergenic
1001048667 5:168396154-168396176 CAGGCAGATCACCTGCAGTCAGG + Intronic
1001241106 5:170070454-170070476 CAGACACACAACATGCATTCGGG - Intronic
1002806020 6:574903-574925 GTGGCACGCCACCTGCCATCTGG - Intronic
1004155390 6:13162869-13162891 GAGGCACAGCGCCTGCTCTCAGG - Intronic
1006916421 6:37596858-37596880 GAGGCACAGAGCCTGCCTTCAGG - Intergenic
1006917100 6:37601786-37601808 GAGGCACAAAGCCTGCCTTCAGG - Intergenic
1007426087 6:41747087-41747109 GAGACACAGCCCCTGCCTTCAGG - Intronic
1011899149 6:92270651-92270673 CAGGCACATCGCCTGCAGTCAGG + Intergenic
1012115145 6:95287042-95287064 GAGGCTCACCATCTGCCTTGGGG + Intergenic
1012781964 6:103571964-103571986 CAGGCAAACGACCTGCAGTCGGG + Intergenic
1016323167 6:142870246-142870268 GAAGCAGACCTCCTGGATTCTGG - Intronic
1017499353 6:155009327-155009349 CAGGCAGACCACCTGAGTTCAGG - Intronic
1017519182 6:155186518-155186540 GAGGCTCAGCATCTTCATTCGGG - Intronic
1018309248 6:162491520-162491542 GAGGCACGGCAACTGCAGTCAGG - Intronic
1019142857 6:169959376-169959398 GACGCACACCTCCTGCCTGCGGG + Intergenic
1019397311 7:828497-828519 CAGGCAGACCACCTGAAGTCAGG - Intronic
1019472770 7:1230044-1230066 GACGCACACGACTCGCATTCAGG - Intergenic
1019606302 7:1911916-1911938 GAGGCCCAGCCCCTGCCTTCAGG - Intronic
1020679210 7:11216071-11216093 GGCGCACACCACTTGCACTCCGG + Intergenic
1020735120 7:11938739-11938761 CAGGCAGATCACCTGCAGTCAGG - Intergenic
1023390327 7:39704412-39704434 GAGGCAGATCACTTGAATTCAGG - Intronic
1024546459 7:50525534-50525556 CAGGCAGATCACCTGCAGTCAGG + Intronic
1024986852 7:55201653-55201675 GAGGCACACCACCTGCATTCAGG + Intronic
1025751570 7:64298366-64298388 GAGTCACATCACCTGAATTCTGG + Intergenic
1025759198 7:64374447-64374469 GAGTCACATCACCTGTATGCTGG - Intergenic
1025759962 7:64380649-64380671 GAGTCACATCACCTGGATGCTGG - Intergenic
1025785424 7:64639449-64639471 GAGTCACATCAGCTGGATTCTGG - Intergenic
1025786896 7:64651997-64652019 GAGTCACAATACCTGCATGCTGG - Intergenic
1025920465 7:65907211-65907233 CAGGCACACCATCTGAAGTCAGG + Intronic
1026198563 7:68194293-68194315 CAAGCAGACCACCTGCAGTCAGG - Intergenic
1026327897 7:69326785-69326807 CAGGCAGACCACCTGCGGTCAGG - Intergenic
1027771633 7:82414631-82414653 AAGGCACACCACATTGATTCAGG + Intronic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1031931079 7:127686542-127686564 GTGGTACACAACCTGCATTATGG + Intronic
1034421383 7:150992910-150992932 GGTGTACCCCACCTGCATTCTGG + Intronic
1034990447 7:155544657-155544679 GAGGCACATGTCCTGCATTCAGG + Intergenic
1035783072 8:2244242-2244264 GAGACCCGCCACCTGCAGTCCGG + Intergenic
1035809053 8:2475344-2475366 GAGACCCGCCACCTGCAGTCCGG - Intergenic
1040375122 8:46817481-46817503 GAGTCACAGCACCTGGATGCTGG - Intergenic
1041520657 8:58752374-58752396 GAGTCACACCAGCTACATTTGGG - Intergenic
1041721849 8:60983419-60983441 GAGGGAAACCAGCTGCATCCCGG - Intergenic
1042360192 8:67874089-67874111 GAGGCAGATCACCTGAAGTCAGG + Intergenic
1043614014 8:82103309-82103331 GAGGCAGACCTACTGCAATCTGG + Intergenic
1049615212 8:143572927-143572949 GAGCCACACCACAGGCACTCAGG - Exonic
1050581907 9:7067379-7067401 GTGGCAGCCCACCTGCATTGGGG + Intronic
1051179610 9:14396470-14396492 GAGGCTCCCCACCTGAATTTGGG - Intronic
1051813825 9:21080976-21080998 TAGGCACACTGCCTGCATTAAGG - Intergenic
1051837196 9:21353604-21353626 CAGGCACACCACTTGAGTTCAGG - Intergenic
1052853565 9:33392998-33393020 CAGGCAGATCACCTGAATTCGGG + Intronic
1057385648 9:94603823-94603845 GAGACAGACCACCTGCATACTGG + Intronic
1060226188 9:121792505-121792527 CAGCCACACCTCCTGCATACAGG + Intergenic
1060823306 9:126673620-126673642 GAGACACTCCACCTCCACTCTGG + Intronic
1061245366 9:129398779-129398801 GAGGCCCACCACCTGGTTTGTGG - Intergenic
1061856505 9:133444616-133444638 CAGGCACCCCACCTGCACCCAGG - Intronic
1061865878 9:133491570-133491592 CAGGCAACCCACATGCATTCTGG + Intergenic
1203423694 Un_GL000195v1:18381-18403 GAGACACATCACCTGCATGCTGG + Intergenic
1203695647 Un_GL000214v1:94783-94805 GTGGTACACCACCTGCAATATGG - Intergenic
1203640626 Un_KI270751v1:9280-9302 GTGGTACACCACCTGCAATATGG + Intergenic
1186776914 X:12874090-12874112 CAGGCAGACCACCTGAAGTCAGG + Intronic
1187252487 X:17611351-17611373 GAGGCACCTTTCCTGCATTCAGG + Intronic
1187470995 X:19569689-19569711 GAGCCCCAGCACCAGCATTCAGG - Intronic
1188829690 X:34881348-34881370 GAGGCACAGCACCACCATTCAGG + Intergenic
1191054720 X:56230151-56230173 AAGGCACACCCACTGTATTCAGG + Intergenic
1198230296 X:134682781-134682803 GGGGCAGATCACCTGAATTCAGG - Intronic
1200104060 X:153702690-153702712 GAGGCCCACCAACTGCAGCCTGG + Intronic
1200855889 Y:7937779-7937801 GAGTTACATCACCTGGATTCTGG + Intergenic
1200862815 Y:8010891-8010913 GAGTCACACTACCTGGATACTGG + Intergenic
1200863079 Y:8013747-8013769 GAGTCACACTTACTGCATTCTGG + Intergenic
1200864296 Y:8026201-8026223 GAGTCACATCACCTGGATGCTGG - Intergenic
1200866205 Y:8046438-8046460 GAGTCACATCACCTGGATCCTGG - Intergenic
1200870026 Y:8087921-8087943 GAGGCAAAACACCTGCATAATGG + Intergenic
1200890186 Y:8315072-8315094 GAGTCACACCACCTTGATCCTGG - Intergenic
1200898017 Y:8396562-8396584 GAGTCACATCACCTGGATGCTGG + Intergenic
1200900937 Y:8431221-8431243 GAGTCACATCACCTGGATGCTGG + Intergenic
1200904857 Y:8471420-8471442 CAGCCACATCACCTGAATTCTGG - Intergenic
1202254240 Y:22904441-22904463 GAGTCACATCACCTGGATGCTGG + Intergenic
1202261186 Y:22972164-22972186 GAGTCACATCACCTGGATGCTGG - Intergenic
1202407230 Y:24538190-24538212 GAGTCACATCACCTGGATGCTGG + Intergenic
1202414174 Y:24605905-24605927 GAGTCACATCACCTGGATGCTGG - Intergenic
1202463551 Y:25131891-25131913 GAGTCACATCACCTGGATGCTGG - Intergenic