ID: 1024987126

View in Genome Browser
Species Human (GRCh38)
Location 7:55205148-55205170
Sequence TGTCATAAGTCTCCTTGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024987121_1024987126 -5 Left 1024987121 7:55205130-55205152 CCCGAGGCTCCTGCTCCCTGTCA 0: 1
1: 1
2: 2
3: 42
4: 360
Right 1024987126 7:55205148-55205170 TGTCATAAGTCTCCTTGTTGAGG 0: 1
1: 0
2: 2
3: 4
4: 116
1024987119_1024987126 -1 Left 1024987119 7:55205126-55205148 CCCTCCCGAGGCTCCTGCTCCCT 0: 1
1: 1
2: 4
3: 45
4: 451
Right 1024987126 7:55205148-55205170 TGTCATAAGTCTCCTTGTTGAGG 0: 1
1: 0
2: 2
3: 4
4: 116
1024987120_1024987126 -2 Left 1024987120 7:55205127-55205149 CCTCCCGAGGCTCCTGCTCCCTG 0: 1
1: 0
2: 5
3: 41
4: 418
Right 1024987126 7:55205148-55205170 TGTCATAAGTCTCCTTGTTGAGG 0: 1
1: 0
2: 2
3: 4
4: 116
1024987122_1024987126 -6 Left 1024987122 7:55205131-55205153 CCGAGGCTCCTGCTCCCTGTCAT 0: 1
1: 0
2: 2
3: 40
4: 365
Right 1024987126 7:55205148-55205170 TGTCATAAGTCTCCTTGTTGAGG 0: 1
1: 0
2: 2
3: 4
4: 116
1024987115_1024987126 29 Left 1024987115 7:55205096-55205118 CCACTTTCTTTTGCAGCAACAGC 0: 1
1: 0
2: 2
3: 21
4: 251
Right 1024987126 7:55205148-55205170 TGTCATAAGTCTCCTTGTTGAGG 0: 1
1: 0
2: 2
3: 4
4: 116
1024987114_1024987126 30 Left 1024987114 7:55205095-55205117 CCCACTTTCTTTTGCAGCAACAG 0: 1
1: 0
2: 0
3: 37
4: 300
Right 1024987126 7:55205148-55205170 TGTCATAAGTCTCCTTGTTGAGG 0: 1
1: 0
2: 2
3: 4
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024987126 Original CRISPR TGTCATAAGTCTCCTTGTTG AGG Intronic
902844670 1:19100506-19100528 TGTAAGAAGTCTTCTTGTTGGGG + Exonic
905715552 1:40146415-40146437 TCTCATAATTCTCATAGTTGTGG - Intergenic
907725866 1:57019780-57019802 AATCATAAATCTCCTTGCTGTGG + Intronic
907755156 1:57303924-57303946 TGTCATAGTCCTCCTTATTGTGG + Intronic
908106557 1:60849373-60849395 TGTAATTAGTCTGCTTGATGGGG - Intergenic
1066451988 10:35537963-35537985 TCCCATAATTCCCCTTGTTGTGG + Intronic
1067996145 10:51275752-51275774 TGTCACAGGTCTCTTTTTTGGGG - Intronic
1070652697 10:78249488-78249510 TGTCAAAAGATTCCTTGTTCGGG + Intergenic
1071106379 10:82101199-82101221 TGTGATAACTCTCTTTGTTTTGG + Intronic
1077232367 11:1463537-1463559 TGCCATGAGTCTCCTGGTAGGGG + Intergenic
1079345724 11:19650478-19650500 TGTTTTAAGCCTCCTGGTTGTGG + Intronic
1079492347 11:21002736-21002758 TCTTATAAGTCACCTTGGTGAGG + Intronic
1079543558 11:21605485-21605507 TGTCTTAAGCCTCCTTCTTGTGG - Intergenic
1088537774 11:110879975-110879997 TGTCTTAAATCTCCAAGTTGTGG + Intergenic
1088732921 11:112699271-112699293 TGTCATCAGTCACCCTGCTGAGG - Intergenic
1090796379 11:130139027-130139049 GGTCATAAGCATCCTTGCTGAGG + Intronic
1092679607 12:10963639-10963661 TGTCATAAGTCTCCATATACAGG - Intronic
1093191236 12:16077580-16077602 TGTTTTAAGTCTCCATGTTTTGG - Intergenic
1101110956 12:101485433-101485455 TGTGATATTTCTCATTGTTGTGG - Intronic
1101836188 12:108297014-108297036 TTTCATAAGCTTCCTGGTTGTGG - Intronic
1107687356 13:42916563-42916585 TGTAATAAATTACCTTGTTGGGG + Intronic
1112208485 13:97348707-97348729 AGTCATAGCTCTCCTTCTTGAGG - Intronic
1120484346 14:85092244-85092266 TGTCATCATTCTATTTGTTGAGG + Intergenic
1125770244 15:42160432-42160454 TGTGACAAGTTTCCTTGTTCAGG + Exonic
1131606559 15:93909919-93909941 TGTTTGAAGTCTCCTTGTGGAGG - Intergenic
1133633394 16:7643344-7643366 TGAAATAAGTCTTCTTTTTGTGG - Intronic
1135112726 16:19703322-19703344 TTTCTTAAGTCTCTTTGATGTGG + Exonic
1142522760 17:516746-516768 TGTTAAATGTCTCCTTGATGGGG - Exonic
1142903171 17:3026107-3026129 TCTCTTACTTCTCCTTGTTGGGG - Exonic
1143881531 17:10033822-10033844 TGGAATGAGTCTCCGTGTTGGGG - Intronic
1144702845 17:17350071-17350093 TGTCAACAGTCTCCTGATTGAGG + Intergenic
1146476416 17:33166339-33166361 TGTCAAAAAGCTCATTGTTGGGG + Intronic
1153070243 18:1097514-1097536 TGACATAAGTCTTGTTGTCGGGG + Intergenic
1153964071 18:10165240-10165262 TTTCATAAGTGTCCTTGATTCGG + Intergenic
1157130607 18:45003931-45003953 TGCCAAAAGTCTCCTGGTGGGGG - Intronic
1158019327 18:52822817-52822839 TGTCATAATTAACCTTCTTGTGG - Intronic
1159172915 18:64796254-64796276 TTTTATAAGTCTTCTTCTTGAGG - Intergenic
1159735546 18:72093142-72093164 TGTCATAGGTATCCTTTTTGTGG + Intergenic
1160313117 18:77816205-77816227 TCTACTAAGCCTCCTTGTTGGGG + Intergenic
1164737012 19:30549009-30549031 TTCCATCAGGCTCCTTGTTGGGG - Exonic
926921276 2:17942705-17942727 GTTCTTCAGTCTCCTTGTTGGGG - Intronic
927644122 2:24864992-24865014 TGTAATAAATATCCTTGTAGCGG - Intronic
931953010 2:67386179-67386201 TGTCACAAGTGTCCTAGTTTAGG + Intergenic
935634671 2:105241220-105241242 TGCAGTAAGTGTCCTTGTTGAGG - Intergenic
941578068 2:167260668-167260690 TGCCAATAGTCACCTTGTTGAGG + Intergenic
942006904 2:171711475-171711497 TGACATAAAATTCCTTGTTGAGG - Intronic
943785424 2:191872421-191872443 TGTCTTTATTCTCTTTGTTGGGG - Intergenic
947416658 2:229903565-229903587 AGTAAGAAGACTCCTTGTTGTGG - Intronic
1170324559 20:15142271-15142293 TTTGAAAAGACTCCTTGTTGAGG + Intronic
1173047031 20:39522321-39522343 TGTCATCAGTCTCCCAGGTGAGG - Intergenic
1173544647 20:43885647-43885669 TGACATATTTCTCCTTTTTGGGG + Intergenic
1178007697 21:28241569-28241591 TAGAATAAGTCTCCTTTTTGGGG - Intergenic
1179619835 21:42606599-42606621 TGTCAGAAATTTCCTTGTTTAGG + Intergenic
1181468433 22:23123299-23123321 TCTCCTTGGTCTCCTTGTTGCGG - Exonic
1182478406 22:30589816-30589838 TCTAATAAGTCTCCTGGTAGTGG - Intronic
1182880622 22:33729906-33729928 AGGCATGAGTCTCATTGTTGGGG + Intronic
1183839040 22:40482455-40482477 TGTCATCAGTCTCTTTCCTGAGG + Intronic
1184548192 22:45188164-45188186 TATTATCAGACTCCTTGTTGGGG + Intergenic
949186172 3:1194614-1194636 TCTCAAAAGTCTCCTTTGTGAGG - Intronic
951157031 3:19367989-19368011 GGTCATAAGTCTCCCTTTTAGGG - Intronic
952209890 3:31219741-31219763 GGTTAAAAGTCTCCATGTTGTGG - Intergenic
952571797 3:34726405-34726427 TGTCATAGCTCTTGTTGTTGTGG + Intergenic
952623985 3:35381837-35381859 TGTCATAATACACCTTGTTAGGG - Intergenic
953468602 3:43147080-43147102 TGTCATAAGTCTACTTTTGTGGG - Intergenic
954285453 3:49615911-49615933 TGGCATATGTGTCCTAGTTGAGG - Intronic
955690420 3:61585381-61585403 AGTCATAAGACTGCGTGTTGAGG - Intronic
959332955 3:105029517-105029539 TGTCACCAGTGTTCTTGTTGTGG - Intergenic
959564085 3:107816376-107816398 TGTCATAATTCTCCAAGTTTTGG + Intergenic
959671201 3:108979211-108979233 TGTCATAAGAGCCTTTGTTGGGG + Intronic
959913478 3:111791437-111791459 TCTCAAAAGTATCTTTGTTGAGG + Intronic
960129627 3:114041700-114041722 TGACATCATTCTCCTTGTTTAGG - Intronic
962655284 3:137537800-137537822 TGTCGTAATTCTCATTGTAGAGG + Intergenic
962824798 3:139090903-139090925 TGTATTAAGTCTCCTTCTTTGGG + Intronic
970664878 4:18325401-18325423 TCTCATAAGTCTCATAGTAGAGG - Intergenic
979608306 4:122662928-122662950 TAACATGAGTCTCCTTGTGGAGG + Intergenic
981759031 4:148173362-148173384 AATCATAAGGCTCCTTATTGGGG + Intronic
982845113 4:160242668-160242690 TTTCATAGTTCTCCTTGTAGAGG + Intergenic
987546713 5:19320007-19320029 TGCCATAATTTTCCTTGCTGTGG + Intergenic
988608309 5:32701922-32701944 TGACATAAGTATCTCTGTTGTGG + Intronic
989393649 5:40929324-40929346 TCTCCTAAGTCTCCATGTTTGGG + Intronic
993317595 5:86430259-86430281 TGTCAGAAGTATCCTTGTTATGG + Intergenic
996483770 5:124006164-124006186 TTTCTTAAGTGTCCTGGTTGGGG + Intergenic
999885219 5:155915179-155915201 TCTCAAAAGTGTCCTTGTAGGGG - Intronic
999927445 5:156394496-156394518 TGTAATAATTGTCCTTTTTGTGG - Intronic
1004775303 6:18837745-18837767 TGTAATAAGTGGCCTTGGTGTGG - Intergenic
1011879316 6:92004500-92004522 TGTCTGAAGTTTCCTTCTTGTGG + Intergenic
1011905840 6:92366342-92366364 GGTCATAAGACTTCATGTTGAGG - Intergenic
1012799776 6:103810473-103810495 TGTCATAAATTTCATTGTTTGGG + Intergenic
1016392104 6:143585036-143585058 TGTCATAACTCAAGTTGTTGGGG + Intronic
1020151266 7:5683658-5683680 TGTCCTCATTCTCCTTGATGAGG - Intronic
1020891777 7:13887219-13887241 TTTCATATTTCTCCTTGTTTTGG + Intergenic
1021572151 7:22076942-22076964 TGTCATAGATGTCATTGTTGTGG + Intergenic
1021663895 7:22953059-22953081 TGACAGAATTCTCCTTATTGAGG + Intronic
1021934557 7:25616879-25616901 TGTCATAAATTACCTTGCTGGGG + Intergenic
1023901811 7:44487423-44487445 TGGCATAAGACTCCTTCCTGGGG - Intronic
1024987126 7:55205148-55205170 TGTCATAAGTCTCCTTGTTGAGG + Intronic
1028927395 7:96373383-96373405 TGACATAATTCTACTTGATGAGG + Intergenic
1033561233 7:142533916-142533938 TGTCATAAATGTCCTTTTTTAGG - Intergenic
1035797511 8:2372645-2372667 TGTCGTAATTCTCCTAGTTAAGG - Intergenic
1037094685 8:14971213-14971235 TTTCAGAAGACTCCTTGTAGAGG + Intronic
1039108935 8:34020632-34020654 TGACTTAAGTCACCTTTTTGCGG - Intergenic
1044387011 8:91601157-91601179 AGTCATCAGTGTCTTTGTTGTGG - Intergenic
1048546355 8:135391025-135391047 TGTTTTAAGCCTCCTTGTTTTGG + Intergenic
1048584627 8:135763118-135763140 TGTCATAATTCTTCTTTATGGGG + Intergenic
1048727623 8:137404748-137404770 TTTCATAATTCTCATTGTAGAGG - Intergenic
1049286586 8:141778813-141778835 TGTCATGAGTGTCCTTGTCAGGG + Intergenic
1049383729 8:142330532-142330554 TGTCTGAAGGCTCCCTGTTGGGG - Intronic
1051074300 9:13211997-13212019 TGGCAAAAATCTCCATGTTGGGG + Intronic
1059253251 9:112906058-112906080 TCTCTTAAGTCTGCTTTTTGGGG - Intergenic
1059889448 9:118785205-118785227 TGGCATAAGTCCCCATGTGGGGG + Intergenic
1185551596 X:986445-986467 TACGAGAAGTCTCCTTGTTGGGG - Intergenic
1186013774 X:5167619-5167641 TGTCAAATGTCTCCTGGTAGGGG + Intergenic
1188114881 X:26231141-26231163 TCTCATAATTCCCATTGTTGTGG - Intergenic
1188299748 X:28493674-28493696 TGTCATAATTCCCATTTTTGTGG - Intergenic
1188722628 X:33542423-33542445 TGTAATAATGCTCCTTGTGGAGG - Intergenic
1190271573 X:48868095-48868117 TGTCAGCAATCTCCTGGTTGTGG + Intergenic
1198048901 X:132929873-132929895 TGAAATAAGTCTCCTAGCTGTGG - Intronic
1198232863 X:134709063-134709085 TGGCATATATCTCCTTTTTGAGG - Intronic
1198701726 X:139404196-139404218 TGTCAAAAGTCTGTATGTTGGGG + Intergenic
1199223857 X:145348858-145348880 AGTCATAAGTAGCCCTGTTGTGG + Intergenic
1200055178 X:153456500-153456522 AGTCATCACTCTGCTTGTTGAGG + Exonic
1202179692 Y:22129000-22129022 TGTCATCAGTCTCCTTGTGGAGG - Intergenic
1202211669 Y:22457394-22457416 TGTCATCAGTCTCCTTGTGGAGG + Intergenic