ID: 1024992892

View in Genome Browser
Species Human (GRCh38)
Location 7:55250394-55250416
Sequence GACTCAGGACAGCCCCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 252}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024992892_1024992904 16 Left 1024992892 7:55250394-55250416 CCTCCAGGGGGCTGTCCTGAGTC 0: 1
1: 0
2: 1
3: 15
4: 252
Right 1024992904 7:55250433-55250455 GGAGAAAGGAGGCAAGGGCTGGG 0: 1
1: 0
2: 1
3: 68
4: 808
1024992892_1024992903 15 Left 1024992892 7:55250394-55250416 CCTCCAGGGGGCTGTCCTGAGTC 0: 1
1: 0
2: 1
3: 15
4: 252
Right 1024992903 7:55250432-55250454 CGGAGAAAGGAGGCAAGGGCTGG 0: 1
1: 0
2: 1
3: 41
4: 646
1024992892_1024992905 20 Left 1024992892 7:55250394-55250416 CCTCCAGGGGGCTGTCCTGAGTC 0: 1
1: 0
2: 1
3: 15
4: 252
Right 1024992905 7:55250437-55250459 AAAGGAGGCAAGGGCTGGGAAGG No data
1024992892_1024992895 -5 Left 1024992892 7:55250394-55250416 CCTCCAGGGGGCTGTCCTGAGTC 0: 1
1: 0
2: 1
3: 15
4: 252
Right 1024992895 7:55250412-55250434 GAGTCTAACCACAGTATTCCCGG 0: 1
1: 0
2: 0
3: 2
4: 67
1024992892_1024992896 2 Left 1024992892 7:55250394-55250416 CCTCCAGGGGGCTGTCCTGAGTC 0: 1
1: 0
2: 1
3: 15
4: 252
Right 1024992896 7:55250419-55250441 ACCACAGTATTCCCGGAGAAAGG No data
1024992892_1024992898 5 Left 1024992892 7:55250394-55250416 CCTCCAGGGGGCTGTCCTGAGTC 0: 1
1: 0
2: 1
3: 15
4: 252
Right 1024992898 7:55250422-55250444 ACAGTATTCCCGGAGAAAGGAGG No data
1024992892_1024992899 10 Left 1024992892 7:55250394-55250416 CCTCCAGGGGGCTGTCCTGAGTC 0: 1
1: 0
2: 1
3: 15
4: 252
Right 1024992899 7:55250427-55250449 ATTCCCGGAGAAAGGAGGCAAGG 0: 1
1: 1
2: 2
3: 17
4: 203
1024992892_1024992900 11 Left 1024992892 7:55250394-55250416 CCTCCAGGGGGCTGTCCTGAGTC 0: 1
1: 0
2: 1
3: 15
4: 252
Right 1024992900 7:55250428-55250450 TTCCCGGAGAAAGGAGGCAAGGG 0: 1
1: 0
2: 1
3: 14
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024992892 Original CRISPR GACTCAGGACAGCCCCCTGG AGG (reversed) Intronic
900031359 1:375263-375285 GGCCCAGGACTGACCCCTGGAGG - Intergenic
900051911 1:603463-603485 GGCCCAGGACTGACCCCTGGAGG - Intergenic
900494839 1:2971731-2971753 GCCTCAGCCCAGCCCCCAGGGGG - Intergenic
900990702 1:6096941-6096963 GACTCCTGACATCCCCCTAGAGG - Intronic
902341432 1:15785895-15785917 GACTCAACACAGCACCCGGGAGG - Intronic
902724244 1:18324444-18324466 GGCTCATGACCGCCCCCTGCAGG - Intronic
902819551 1:18935552-18935574 GAGTCGGGTCAGCCTCCTGGAGG - Intronic
903448690 1:23438171-23438193 GAATCAGGAAAGGCTCCTGGAGG - Intronic
904172128 1:28598812-28598834 GCCTCAGGCCAGCCCCAGGGTGG + Intronic
906321864 1:44822321-44822343 GACGCAGGATGGACCCCTGGAGG - Exonic
907920265 1:58904996-58905018 GAATCAGGAAAGCTGCCTGGAGG - Intergenic
908510464 1:64846762-64846784 GTCTCAGGCCAGCCTCCAGGGGG + Intronic
911580703 1:99630265-99630287 GAGGCAGTACAGACCCCTGGGGG + Intergenic
913572200 1:120131832-120131854 GACTCAAGCCAGAGCCCTGGTGG + Intergenic
913673041 1:121116108-121116130 GGCACAGGACAGTCCTCTGGGGG - Intergenic
914024818 1:143903469-143903491 GGCACAGGACAGTCCTCTGGGGG - Intergenic
914293120 1:146293476-146293498 GACTCAAGCCAGAGCCCTGGTGG + Intergenic
914554164 1:148744259-148744281 GACTCAAGCCAGAGCCCTGGTGG + Intergenic
914663248 1:149811189-149811211 GGCACAGGACAGTCCTCTGGGGG - Intronic
914740946 1:150464520-150464542 GATGCAGGACTGACCCCTGGTGG - Exonic
915588526 1:156858051-156858073 GACACAGGACAGGGCCCTGGAGG + Intronic
915913909 1:159930137-159930159 GACGCAGGAGAGCCCCTAGGAGG + Intronic
917252522 1:173077530-173077552 CACTGAGGCCAGCACCCTGGAGG + Intergenic
917659711 1:177164986-177165008 GAATCAGGTCAGCCCCCAGCTGG + Intergenic
1062938450 10:1404756-1404778 GACCCTGGACAGACCCCTGAGGG + Intronic
1063582084 10:7317138-7317160 CACTCAGGACATGACCCTGGGGG - Intronic
1067288555 10:44924820-44924842 GACTGAGGAATGCCACCTGGCGG - Intronic
1067708259 10:48627156-48627178 AACTCAGGACAGCCTGCTGCAGG - Intronic
1070685974 10:78481452-78481474 GACTAAGGACAGAGCTCTGGAGG + Intergenic
1072441980 10:95465028-95465050 GACTCAGGACAGCATCCTTTGGG - Intronic
1072744374 10:97929457-97929479 GAGTCAGGACATCTCCCAGGTGG - Intronic
1075062389 10:119266058-119266080 ACCTCAGGACAGCCTTCTGGGGG - Intronic
1075223063 10:120601061-120601083 AGCTCAGGACCACCCCCTGGTGG + Intergenic
1076685779 10:132197883-132197905 GACCCAGGACAACCTCCTGACGG - Intronic
1076735360 10:132456584-132456606 GCCTCAGAACAGCCTCCTGGAGG - Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077382243 11:2249642-2249664 GCCCCAGCACAGCCCCCAGGTGG + Intergenic
1081834852 11:46144896-46144918 GACTCACTACAGCACCCGGGAGG - Intergenic
1081979825 11:47259354-47259376 GACTCTGGACTGCTCTCTGGAGG - Intronic
1082992643 11:59221314-59221336 GGCTCAGGACAGTCCGTTGGAGG - Intergenic
1083372381 11:62192565-62192587 GCCTCAGGAAAGTCCCCAGGTGG - Intronic
1083612130 11:64009379-64009401 GACACAGGCCTTCCCCCTGGGGG + Intronic
1083833729 11:65250518-65250540 GTCTCATGACAGCCTCCAGGGGG - Intergenic
1084223341 11:67698456-67698478 TTCTCATGACAGCCTCCTGGGGG - Intergenic
1084432991 11:69121897-69121919 GACTCTGGGGAGGCCCCTGGTGG + Intergenic
1084700816 11:70785205-70785227 CACACAGGACAGACCCCTGGGGG + Intronic
1084767193 11:71320315-71320337 GGCCCAGGTCATCCCCCTGGTGG + Intergenic
1084931876 11:72562290-72562312 AACTGAGGACTACCCCCTGGAGG - Intergenic
1085442636 11:76578228-76578250 GTTTCAGGACAGCCCCGTGGGGG - Intergenic
1085502965 11:77039587-77039609 GACTCTGGCCTGCCTCCTGGTGG + Exonic
1085526293 11:77166198-77166220 GACTCAGGCCTGGCCCGTGGGGG - Intronic
1090247186 11:125224854-125224876 TATTCAGGACCGCCCCCCGGAGG + Intronic
1091954438 12:4626650-4626672 ACATCAGGACAGCCCCCTGAAGG - Exonic
1093774366 12:23055200-23055222 GACACAGCACTGCCCCCAGGTGG + Intergenic
1096594178 12:52684110-52684132 GACTGAGGAAAACTCCCTGGAGG - Intergenic
1101553510 12:105785314-105785336 ACCTCAGCACAGACCCCTGGGGG - Intergenic
1102591772 12:113961679-113961701 GAGTCAGGAAAGCTTCCTGGAGG - Intronic
1105279364 13:18954303-18954325 GACTCAGGAGGGCCTCCTGTAGG - Intergenic
1105279950 13:18957677-18957699 CACTCAGGAGGGCCACCTGGTGG - Intergenic
1105375686 13:19842246-19842268 GGCTCTTGACAGCCCCCTGCGGG - Intronic
1105403849 13:20118342-20118364 CGCTCAGGCCAGGCCCCTGGCGG + Intergenic
1106766215 13:32916503-32916525 GACACAGGACAGTCTCCTGGCGG - Intergenic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1114567276 14:23641907-23641929 GAATCAGGACAGATCCCTGCAGG + Intronic
1122310861 14:100793190-100793212 CTCTCAGGACAGAGCCCTGGGGG + Intergenic
1122390252 14:101375338-101375360 AACTCAGCACAGTGCCCTGGTGG - Intergenic
1122651980 14:103231193-103231215 GGCGCAGGACAGACACCTGGGGG + Intergenic
1123187233 14:106531457-106531479 GACTGAGAACAGCCCCCACGTGG + Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202854754 14_GL000225v1_random:43407-43429 GCCTCACGAAAGCCCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1125797958 15:42418003-42418025 GAATCAGAACAGCCCCCAGCTGG + Intronic
1126832603 15:52623496-52623518 AACTCATGACAGAGCCCTGGGGG + Intronic
1129163637 15:73762368-73762390 GAAGGAGGACATCCCCCTGGGGG - Intergenic
1129753435 15:78081878-78081900 GTCTCAGGAGGGTCCCCTGGAGG + Intronic
1130540641 15:84818564-84818586 GTCTCTGGACAGCCTCTTGGAGG - Intronic
1132649145 16:1012703-1012725 GGCTCAGGACACCATCCTGGTGG + Intergenic
1133101240 16:3481456-3481478 CACTCAGGAAAGCCACCCGGAGG - Intronic
1134064831 16:11221338-11221360 GGCTCAGGATAGCCCCCAAGGGG + Intergenic
1136117154 16:28101723-28101745 GACCCGGGACAGGCCCCTGGGGG - Intronic
1138265386 16:55656427-55656449 GACTTCTGACAGCCCTCTGGGGG - Intronic
1138345230 16:56316434-56316456 AACTTAGGACAGCCACCTGTGGG - Intronic
1138491668 16:57380738-57380760 GACCCAAGAGAGCCCCCAGGAGG - Intronic
1138638302 16:58361862-58361884 GACTCAGCACATTCCCATGGTGG - Intronic
1139901441 16:70331769-70331791 CACTCAGCAGAGCCACCTGGTGG - Exonic
1139906538 16:70370270-70370292 CACTCAGCAGAGCCACCTGGTGG - Exonic
1141993824 16:87624639-87624661 GACTCAGGATAGCCCCCAGGTGG - Intronic
1142974818 17:3636967-3636989 GACACGGGACAACCCCCGGGTGG + Intronic
1144849218 17:18235626-18235648 GACTCAGGCCTGGCCCCTGGTGG + Intronic
1146925593 17:36742675-36742697 GACCCAGGACAGCCCTCCTGAGG - Intergenic
1147442850 17:40457984-40458006 GACCAAGGACAGCCCTGTGGGGG + Intergenic
1148215257 17:45830634-45830656 GACTCAGGCCAGCGGGCTGGGGG + Intronic
1150492968 17:65587033-65587055 CACTCCAGACAGCCCCCTGTGGG - Intronic
1151454165 17:74216178-74216200 GTCTCAGGACAGTACCCTGCTGG + Intronic
1152258072 17:79251855-79251877 GCCTGAGGGCAGACCCCTGGTGG - Intronic
1152805654 17:82354585-82354607 GGTTCAGGACAGACCCCAGGAGG + Intergenic
1152805673 17:82354651-82354673 GGTTCAGGACAGACCCCAGGAGG + Intergenic
1152948294 17:83210450-83210472 GGCCCAGGACTGACCCCTGGAGG + Intergenic
1153641841 18:7164249-7164271 GACTGAGGACCGCCCCCATGGGG + Intergenic
1155035129 18:22019642-22019664 AAGGCAGGACAGCCCCCAGGTGG + Intergenic
1156512798 18:37655309-37655331 ACCTCAGGTCAGCCTCCTGGAGG - Intergenic
1157622832 18:49026105-49026127 GATCCAGGACAGCTTCCTGGAGG + Intergenic
1158876984 18:61743240-61743262 GACTGAGGACAGCCAGCTGCCGG - Intergenic
1160462377 18:79048758-79048780 AACTGAGGACTGCGCCCTGGGGG - Intergenic
1161153861 19:2722353-2722375 GACTCTGGAGAGACCCCTGTGGG - Intronic
1162145941 19:8611983-8612005 GGCTCTGGCCAGCTCCCTGGGGG - Intergenic
1162804190 19:13128542-13128564 GACTGAGCCCAGTCCCCTGGAGG + Intronic
1162881622 19:13663979-13664001 GAATCAGGGCAGCCCCATGCAGG - Intergenic
1163822341 19:19503063-19503085 GACTCCGGAGAGCCCACTGGAGG - Intronic
1164635333 19:29787425-29787447 GAGGGAGGACAGCTCCCTGGAGG + Intergenic
1165860278 19:38905718-38905740 GACCCAGGACCCCCACCTGGAGG + Intronic
1167051140 19:47079486-47079508 GACTGAGGACTGCCCCCTGCTGG - Intronic
1167607964 19:50491571-50491593 GAAACAGGAAAGCCCCATGGAGG + Intergenic
926217779 2:10915792-10915814 GACACAGGACAGCCCCTTTCAGG - Intergenic
929588072 2:43128372-43128394 CAGTCAGGAAAGCCTCCTGGAGG + Intergenic
934649943 2:96085020-96085042 GACTCAGGGCCACTCCCTGGTGG - Intergenic
935147983 2:100409185-100409207 GCCTCAGGACAGCACTTTGGAGG + Intronic
935280662 2:101515052-101515074 CACTCAGCACAGTCCCCTGAAGG - Intergenic
937549568 2:123070284-123070306 GACTCAGGAAGGTCTCCTGGTGG + Intergenic
938960158 2:136333469-136333491 GACACAGCACACCCCTCTGGAGG - Intergenic
942897955 2:181080781-181080803 GGGACAGGACAGGCCCCTGGGGG + Intergenic
944137417 2:196414526-196414548 GACTCAGGAAGGCCCCTTTGAGG - Intronic
946256141 2:218443588-218443610 GACTCAAGACAGCCCCATTATGG + Intronic
946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG + Intronic
946413509 2:219527371-219527393 GACTCTGCACAGCCACCTTGAGG + Intronic
948253744 2:236551314-236551336 GCCTCAGGAGACCCCACTGGTGG + Intergenic
1169360788 20:4947102-4947124 GACCCAGGAGTGCTCCCTGGAGG - Intronic
1170562595 20:17569971-17569993 GACTCTGGATAGCCGCCGGGGGG + Exonic
1171387156 20:24778221-24778243 GACTCAGGAGAACCCTCTGTAGG + Intergenic
1171388178 20:24784270-24784292 GGCTCAGGACCTCCTCCTGGTGG - Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1173808048 20:45939011-45939033 GAATCACGGCAGCCCCCGGGAGG + Exonic
1175967283 20:62665969-62665991 GACTCGGCAGAGGCCCCTGGGGG + Intronic
1176117778 20:63440497-63440519 GGCTCAGGACAGCCGCACGGAGG + Intronic
1176377699 21:6094585-6094607 GTATCTGGACAGCTCCCTGGGGG + Intergenic
1177205854 21:18010355-18010377 AACTCAGGAAAGTCTCCTGGTGG + Intronic
1178899780 21:36589552-36589574 GGGTCAGGACTGCCCCCTAGGGG + Intergenic
1178942816 21:36921556-36921578 GGCTCAGGAAAGCCTCATGGTGG + Intronic
1179582362 21:42351903-42351925 CCCTGAGGACAGCCCCGTGGTGG - Intergenic
1179607249 21:42524875-42524897 GCCCCAGGACAACCTCCTGGGGG + Intronic
1179630906 21:42678171-42678193 GACTCAACACAGAGCCCTGGGGG + Intronic
1179718207 21:43300972-43300994 CGCTCAGGACAGGCCCCTGCTGG + Intergenic
1179745775 21:43443659-43443681 GTATCTGGACAGCTCCCTGGGGG - Intergenic
1179818011 21:43920500-43920522 GCTCCAGGACAGCCTCCTGGGGG + Intronic
1179966638 21:44810614-44810636 GGCTCCGGCCAGCCTCCTGGAGG - Intronic
1180023875 21:45147611-45147633 GTCTCAGGCCAGGCCCCCGGGGG + Intronic
1180193845 21:46182143-46182165 GAGCCAGGCCAGCCCCATGGTGG - Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
1181365191 22:22371099-22371121 GGCTTCAGACAGCCCCCTGGAGG + Intergenic
1181368375 22:22397464-22397486 GGCTTCAGACAGCCCCCTGGAGG + Intergenic
1181645868 22:24231673-24231695 GCCTCAGGACTGGCCCCTTGGGG + Intronic
1183600948 22:38840407-38840429 GAGTTAGGAGAGCCCCATGGTGG + Intronic
1183949968 22:41347386-41347408 AACACAGGACAGCGCCCTGTGGG - Intronic
1184616163 22:45640047-45640069 AACCCAGGACAGCTTCCTGGAGG + Intergenic
1184650375 22:45916856-45916878 GACACAGGACAGTGGCCTGGAGG + Intergenic
1184795585 22:46730781-46730803 GACACACGGCATCCCCCTGGGGG + Intronic
1185232031 22:49688922-49688944 TACTCAGGCCAGACACCTGGAGG + Intergenic
952107696 3:30088559-30088581 AACTCAGCGCAGCCCCATGGCGG + Intergenic
953392379 3:42541007-42541029 GACAGAGGGCAGCCCCCTTGGGG + Intergenic
954126830 3:48536263-48536285 GACCCAGGACTGTCCCCTCGGGG - Exonic
954789299 3:53119363-53119385 GAGTGAGGACAGCAGCCTGGAGG - Intronic
955230352 3:57093661-57093683 GGCCCAAGACAGCCCTCTGGAGG + Exonic
956053642 3:65275860-65275882 GAATCAGGACAGAGGCCTGGAGG + Intergenic
956264802 3:67384949-67384971 GCCTCAGGACAGCCTCAAGGTGG + Intronic
957923038 3:86772043-86772065 GACTAAGGACAGCCCTGTGCTGG + Intergenic
966227873 3:177617616-177617638 GACTCAGGATGGCTCCCTGCAGG - Intergenic
969349542 4:6590564-6590586 GACACTGGACAGTGCCCTGGAGG - Intronic
969631709 4:8342890-8342912 GGCTCAGGAGGGCCCCCTGGAGG + Intergenic
971347689 4:25826531-25826553 GACTCTGGACAGCTCCCTCTGGG + Intronic
971385791 4:26139535-26139557 GCCTCAGCACAGCCCCAGGGGGG - Intergenic
975772720 4:77745914-77745936 AACTCAGTTCAGTCCCCTGGGGG + Intronic
975986026 4:80202344-80202366 GACTCAGCTCCGCCTCCTGGTGG - Exonic
978623381 4:110656823-110656845 GACTCAGAACAGCCCACCTGAGG - Intergenic
984943581 4:184954341-184954363 GACCCAGGAAAGCTCCCAGGAGG + Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1000519197 5:162277546-162277568 GAGCCAGGACAGCACCCTGTAGG - Intergenic
1001426494 5:171625959-171625981 GTCTCATGACAGCCCTTTGGGGG - Intergenic
1001648178 5:173297440-173297462 GCCACAGGCCAGCCCACTGGAGG - Intergenic
1002742461 5:181443605-181443627 GGCCCAGGACTGACCCCTGGAGG + Intergenic
1006439378 6:34043644-34043666 GGCTGAGGCCAGCCTCCTGGGGG - Intronic
1008286622 6:49660648-49660670 GGCTCAGGAAAGCTGCCTGGGGG - Intergenic
1010116383 6:72316871-72316893 GACACAGGGCCTCCCCCTGGGGG - Intronic
1010444608 6:75936097-75936119 GCCTCAGGACAGTGCCCTAGCGG + Intronic
1013925791 6:115470067-115470089 GATTCAAGAAAGCTCCCTGGTGG + Intergenic
1016367778 6:143337760-143337782 GTCCCAGCACTGCCCCCTGGTGG + Intronic
1017673280 6:156788085-156788107 GACTCAGGACAAGCCCTTGCTGG + Intronic
1019247597 6:170719344-170719366 GGCCCAGGACTGACCCCTGGAGG + Intergenic
1019347997 7:539882-539904 CACACAGGGCAGCCGCCTGGAGG - Intergenic
1019703633 7:2487358-2487380 GACCCAGGACAGGACGCTGGAGG + Intergenic
1022311399 7:29199949-29199971 CACTCAGGCCAGGCCCCAGGTGG - Intronic
1023030305 7:36085004-36085026 GCCTCAGGTCATCCTCCTGGCGG + Exonic
1023050401 7:36246190-36246212 GACACAGGCCACCCACCTGGTGG + Intronic
1024026234 7:45412315-45412337 GAGTCAGGAAGGCCCCCTGGAGG - Intergenic
1024088612 7:45917757-45917779 GGCTCAGGTCTGCCCCCTGCCGG - Intronic
1024992892 7:55250394-55250416 GACTCAGGACAGCCCCCTGGAGG - Intronic
1028479418 7:91288424-91288446 AACTCAGGAGTGCCCCCTGCTGG - Intergenic
1029107876 7:98193384-98193406 CAGTCAGGACAGCCTCCTGGAGG + Exonic
1029560612 7:101300290-101300312 GCCTGAGGACAGTCCGCTGGCGG + Intergenic
1029561119 7:101303391-101303413 CCCTCAGGACAGTCCGCTGGTGG + Intergenic
1029562023 7:101308986-101309008 GCCTGAGGACAGTCCACTGGCGG + Intergenic
1029712044 7:102304963-102304985 CACTCAGGCCAGCCCCAAGGGGG + Intronic
1032274102 7:130439789-130439811 AACTCAGAACAGGCCCCTGTAGG - Intronic
1033598571 7:142873432-142873454 GGCCCAGGTGAGCCCCCTGGTGG - Exonic
1034969968 7:155412824-155412846 GGCACAGGAAAGCCCCCTAGAGG + Intergenic
1035500540 8:88592-88614 GGCCCAGGACTGACCCCTGGAGG - Intergenic
1035919450 8:3661409-3661431 GCCTCAGCACAGCCACGTGGTGG - Intronic
1037961216 8:23099725-23099747 GACTGAGGGCAGTGCCCTGGGGG - Intronic
1037970460 8:23168132-23168154 GACTGAGGGCAGTGCCCTGGGGG + Intergenic
1038325731 8:26571412-26571434 GCCTCAGGCCTGCCCTCTGGTGG - Intronic
1039919686 8:41884505-41884527 GACTCAGGAAAGCTTCCTGGAGG + Intronic
1041390959 8:57347231-57347253 GACTCAGGAGAGACAGCTGGCGG - Intergenic
1041765885 8:61417870-61417892 GAGTGAGGACAGCCACCAGGTGG - Intronic
1047713376 8:127573850-127573872 CACTCATGGCAGCCTCCTGGTGG - Intergenic
1048007991 8:130434643-130434665 GCCAAAGGACAGCCCACTGGAGG + Intronic
1049807117 8:144546113-144546135 GAATGAGGTCAGCCCCCTGGGGG - Intronic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1054945876 9:70795629-70795651 GAATAAGGAGAGGCCCCTGGGGG - Intronic
1056717771 9:89046884-89046906 GTATCAAGAAAGCCCCCTGGAGG + Exonic
1057134771 9:92680115-92680137 GACACAGGCCAGCCACCTGCTGG + Intergenic
1057736481 9:97666541-97666563 GATTCAGGCGAGCCCCCTGAGGG - Intronic
1059753209 9:117268449-117268471 GATTAAGGAAAGCCTCCTGGAGG - Intronic
1060917971 9:127402660-127402682 GACTCAGCACAGGCGCCAGGAGG + Exonic
1061876901 9:133548616-133548638 GGCTTCGGCCAGCCCCCTGGGGG + Intronic
1061900709 9:133670702-133670724 GCCAGACGACAGCCCCCTGGAGG - Exonic
1062572423 9:137191812-137191834 GAATCTGCACAGCCCCCTGCCGG + Exonic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1186216935 X:7310707-7310729 GGCCCAGGACAGAGCCCTGGAGG - Intronic
1186269282 X:7867278-7867300 AACTCGGGATAGCCCCCTTGAGG + Intergenic
1186837805 X:13455323-13455345 CACACAGGACAGCCCCACGGCGG + Intergenic
1188482872 X:30652974-30652996 GACTCTGCACAGCCCACTGGAGG + Intergenic
1195821064 X:108945976-108945998 GACTCAGAATAGTCACCTGGTGG - Intergenic
1197262716 X:124334426-124334448 GCCCCAGGACACTCCCCTGGGGG + Intronic
1197262765 X:124334612-124334634 GCCCCAGGACACTCCCCTGGGGG + Intronic
1197655533 X:129112591-129112613 GTCCCAGGACAGCTCCATGGAGG - Intergenic
1198414045 X:136401861-136401883 GTCTCCTGACAGCCTCCTGGAGG + Intronic
1200150186 X:153947464-153947486 GGCTCACGGGAGCCCCCTGGAGG - Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic