ID: 1024992957

View in Genome Browser
Species Human (GRCh38)
Location 7:55250786-55250808
Sequence CTCCTAAGAATCTCTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 160}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024992957_1024992961 13 Left 1024992957 7:55250786-55250808 CCAGACACAGAGATTCTTAGGAG 0: 1
1: 0
2: 0
3: 14
4: 160
Right 1024992961 7:55250822-55250844 CTGACTCCAGGAGAGAATCCAGG No data
1024992957_1024992965 30 Left 1024992957 7:55250786-55250808 CCAGACACAGAGATTCTTAGGAG 0: 1
1: 0
2: 0
3: 14
4: 160
Right 1024992965 7:55250839-55250861 TCCAGGGGAAAAGATATATTTGG 0: 1
1: 0
2: 0
3: 18
4: 243
1024992957_1024992962 14 Left 1024992957 7:55250786-55250808 CCAGACACAGAGATTCTTAGGAG 0: 1
1: 0
2: 0
3: 14
4: 160
Right 1024992962 7:55250823-55250845 TGACTCCAGGAGAGAATCCAGGG 0: 1
1: 0
2: 0
3: 32
4: 242
1024992957_1024992963 15 Left 1024992957 7:55250786-55250808 CCAGACACAGAGATTCTTAGGAG 0: 1
1: 0
2: 0
3: 14
4: 160
Right 1024992963 7:55250824-55250846 GACTCCAGGAGAGAATCCAGGGG No data
1024992957_1024992960 1 Left 1024992957 7:55250786-55250808 CCAGACACAGAGATTCTTAGGAG 0: 1
1: 0
2: 0
3: 14
4: 160
Right 1024992960 7:55250810-55250832 AAAACGAGGCAGCTGACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024992957 Original CRISPR CTCCTAAGAATCTCTGTGTC TGG (reversed) Intronic
900005219 1:40983-41005 CTCCTGAGAATCTCTGGCTGAGG - Intergenic
901353372 1:8619307-8619329 CTCTAAGGAATCTCTGTATCTGG + Intronic
903302533 1:22389654-22389676 CTCCTGAGAAACTCTGTGCCAGG - Intergenic
906493865 1:46289464-46289486 CTCTTAAGAATCTATGGGCCGGG + Intronic
911534502 1:99084147-99084169 GTCCCAAGAATCACTGAGTCAGG + Intergenic
913658278 1:120982659-120982681 CTCATAAGAATCTTTGAGGCTGG + Intergenic
914009638 1:143765748-143765770 CTCATAAGAATCTTTGAGGCTGG + Intergenic
914648260 1:149674423-149674445 CTCATAAGAATCTTTGAGGCTGG + Intergenic
918149187 1:181783366-181783388 GTCCTAAGAATGTCTTTGTTAGG - Intronic
918267496 1:182858359-182858381 CTGCTAATCATCTCTGTGTCTGG + Intronic
1062968302 10:1626942-1626964 CTCCTAAGAATCCCTCTCTGTGG + Intronic
1065045887 10:21747445-21747467 CTCCTTAGGAACTCTGAGTCGGG - Intergenic
1066697035 10:38088153-38088175 CTCCTTAGAAACTCAGTGCCTGG + Intergenic
1068528114 10:58154197-58154219 CACCTAAGATTCTTTGTCTCAGG + Intergenic
1069117272 10:64523306-64523328 CTCCTGGAAATCTCTGTGCCAGG - Intergenic
1069268593 10:66494641-66494663 CTCTCAACAATTTCTGTGTCAGG - Intronic
1071302528 10:84266891-84266913 CACATCAGAATCTCTGTGCCAGG - Intergenic
1072034229 10:91549874-91549896 TTCCTAAGAATAGCTGTCTCAGG - Intergenic
1072439264 10:95439339-95439361 CTCCCCAGAATCTCTCTCTCAGG - Intronic
1075430690 10:122378200-122378222 CTCCTGAGAATTTCCATGTCAGG + Intronic
1076438441 10:130462678-130462700 CACCTTAGCATTTCTGTGTCAGG + Intergenic
1077980973 11:7300585-7300607 CTCCTAGCAGTGTCTGTGTCAGG + Intronic
1078050421 11:7960893-7960915 TGCCTCAGAATCTCTGTGACAGG + Exonic
1078685332 11:13524805-13524827 GTCATAAGAATCCCTGTCTCAGG + Intergenic
1081988115 11:47321939-47321961 CTCCTGAGCTTCTCAGTGTCTGG - Intronic
1084064730 11:66697262-66697284 CTCCCTAGAATCACTGTTTCAGG + Intronic
1084963873 11:72733314-72733336 CTCCTGACAGGCTCTGTGTCAGG - Intronic
1088465029 11:110125826-110125848 CTCATCAGATTCTCTGTCTCAGG + Intronic
1092387972 12:8050772-8050794 CTGCTAAGAAGGTGTGTGTCGGG + Intronic
1092481540 12:8863472-8863494 CTTATAAGAATCTCTGTGTTTGG - Intronic
1095874598 12:47066971-47066993 CTCCTAACAACCTCTGCGTTAGG - Intergenic
1098608933 12:72430814-72430836 ATGCTTTGAATCTCTGTGTCAGG + Intronic
1100062824 12:90602292-90602314 GTCCTAAACTTCTCTGTGTCTGG + Intergenic
1100309542 12:93381501-93381523 CTCCTAAGAATCATTCTGTAGGG + Intronic
1100366139 12:93922492-93922514 TGCCTAACAATCTCTGTGTATGG + Intergenic
1100403700 12:94254137-94254159 TTCCTCAGCATCTCTGTGCCTGG - Intronic
1100955760 12:99906121-99906143 CTCCTAAGAATTTCTGAGTGTGG - Intronic
1101903773 12:108810656-108810678 CTGCTTAGAATCCCCGTGTCAGG + Intronic
1102010829 12:109617381-109617403 CTCCCAAGGAGCTCTGTTTCAGG - Intergenic
1105087799 13:16229987-16230009 TTTCTGAGAATCTTTGTGTCTGG - Intergenic
1105088004 13:16233745-16233767 TTTCTGAGAATCTTTGTGTCTGG - Intergenic
1105088211 13:16237503-16237525 TTTCTGAGAATCTTTGTGTCTGG - Intergenic
1105088418 13:16241263-16241285 TTTCTGAGAATCTTTGTGTCTGG - Intergenic
1105088834 13:16248779-16248801 TTTCTGAGAATCTTTGTGTCTGG - Intergenic
1105997953 13:25690887-25690909 CTTCTATGAATCTGTGTGACTGG - Intronic
1106168836 13:27271500-27271522 CTCCAATGAATCTCTTGGTCAGG - Exonic
1106984992 13:35336009-35336031 TTCCTAAGGAACTCTGTGTAAGG - Intronic
1108211153 13:48141195-48141217 TTCCTAATAAGCTCTGTGTCTGG - Intergenic
1109969638 13:69750938-69750960 CTTTTAAACATCTCTGTGTCTGG - Intronic
1113835813 13:113327898-113327920 GTTCTAAGCTTCTCTGTGTCTGG - Intronic
1114164400 14:20204582-20204604 ATCCTAGGATTCTCTGGGTCAGG + Intergenic
1114811980 14:25911622-25911644 CATCTAAGAATCTCTGTGCAGGG + Intergenic
1115106474 14:29767751-29767773 CACCTCAGAATCTCTCTCTCAGG + Intronic
1115641895 14:35340423-35340445 CTCCTCAGCACCTCTGTGCCAGG + Intergenic
1117621207 14:57588731-57588753 CTGCTAGGCATCTCAGTGTCAGG + Intronic
1118267265 14:64306738-64306760 TTTCTAAGAATGTCTTTGTCAGG + Intronic
1118704599 14:68469104-68469126 CACCTAAGCATCTCTGTGGTTGG - Intronic
1119579563 14:75765246-75765268 CTCCTGTGAACGTCTGTGTCAGG + Intronic
1120592334 14:86390700-86390722 GTCCTAAGAGTGTCTGAGTCTGG - Intergenic
1120626092 14:86828108-86828130 CTCCCAAGAATCTCAGGGTCTGG - Intergenic
1121213261 14:92225641-92225663 CACCTGAGAATCTCTGGGTTTGG - Intergenic
1123634260 15:22287873-22287895 CTCTAAGGAATCTCTGTATCTGG - Intergenic
1124884024 15:33667761-33667783 CTACTAAAAATCCCTGAGTCAGG + Intronic
1126522330 15:49609588-49609610 ATCCTAAGCATCTATGTGCCTGG + Intronic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1128891853 15:71338685-71338707 CTTCTAATAATCTCAGTGTTTGG - Intronic
1129452902 15:75660749-75660771 GTCATAAGCATCTCTGTGCCTGG + Exonic
1130154254 15:81335976-81335998 GCCCAAAGAATCTCTTTGTCTGG - Intronic
1132408268 15:101558083-101558105 CTCCTAAGAATATCGGTCTTTGG - Intergenic
1132448294 15:101949958-101949980 CTCCTGAGAATCTCTGGCTGAGG + Intergenic
1137327115 16:47451397-47451419 CTCCTAATAGTATCTGTGGCTGG + Exonic
1139543596 16:67637236-67637258 CTTCTAAGAAACTCAGGGTCAGG + Intronic
1141081880 16:81060152-81060174 CTCATACTAATCTCTGTGTCTGG - Intronic
1142668076 17:1473745-1473767 CTTTTTAGACTCTCTGTGTCTGG + Intronic
1145037963 17:19554345-19554367 CTCCCACGAAGCTCTGTGCCTGG + Intronic
1147713443 17:42487201-42487223 CTGCTAAGAACATCCGTGTCTGG + Exonic
1148397512 17:47321808-47321830 CTTTTAAGAATGGCTGTGTCAGG - Intronic
1152018302 17:77766515-77766537 CACATAAAAATCTCTATGTCTGG + Intergenic
1152884314 17:82840518-82840540 CTCCTGAGAGTCTCTGTCCCTGG + Exonic
1152884610 17:82842253-82842275 CTCCTGAGAGTCTCTGTCCCTGG + Intronic
1153516243 18:5904657-5904679 GTACTAAGAATCTCTGTCTTCGG + Intergenic
1156176116 18:34548629-34548651 CTACTAGGAATCTTAGTGTCAGG - Intronic
1160636973 19:82594-82616 CTCCTGAGAATCTCTGGCTGAGG - Intergenic
1161299965 19:3537815-3537837 CTCATAAGCTTCTCTGTCTCTGG - Intronic
1163284115 19:16335588-16335610 GGCCTAAGAGTCTCTGGGTCTGG - Intergenic
1166151204 19:40876988-40877010 CTCCCCAGACTCTTTGTGTCGGG - Intronic
1167876236 19:52415018-52415040 CTCCTACCAATGTCTGAGTCAGG + Intronic
1167912028 19:52711549-52711571 CTCCTCATATTTTCTGTGTCTGG - Intronic
1168397417 19:56060588-56060610 TTCCTCAGAGTCTCTGTGCCGGG - Intronic
925206971 2:2015223-2015245 CTCCGAGGAGTCTCTGTTTCTGG + Intronic
926880126 2:17536450-17536472 CTGCTATGAATCTATATGTCAGG + Intergenic
929678284 2:43961294-43961316 CCCCTAAAAGTCTCTGTTTCTGG - Intronic
929963028 2:46510876-46510898 CTGCAAAGTATCTCTGTGCCTGG - Intronic
930933698 2:56920306-56920328 GGCCTTAGAAACTCTGTGTCTGG - Intergenic
931054965 2:58459218-58459240 CTACTTAGGATCTCTGTCTCAGG - Intergenic
931510848 2:62991809-62991831 CTTCAAAGCATCTCTGTGTCAGG - Intronic
931714188 2:65016135-65016157 CTCCTGGGAATCCCTGTGACTGG + Intronic
932396046 2:71448858-71448880 CTTCTAACAATCGCTGTGTGTGG + Intergenic
934567930 2:95350829-95350851 CTCCTAAAAATCCCAGTGCCTGG - Intronic
940902573 2:159139382-159139404 GTCCTAATAAGCTGTGTGTCAGG + Intronic
942530114 2:176900899-176900921 CTCCTTAGAAACTCAGTGCCTGG + Intergenic
943719313 2:191186787-191186809 GTACTAAGAATCTCTCTGTCTGG - Intergenic
945552132 2:211233442-211233464 CTACTAAGATTCTTTGTATCAGG + Intergenic
945708972 2:213272607-213272629 CTCCTCAAATTTTCTGTGTCTGG - Intergenic
948395149 2:237639963-237639985 CAACTGAGGATCTCTGTGTCAGG + Intronic
1174283039 20:49453082-49453104 TGCCTAAGAATCCCTGTCTCAGG - Intronic
1174684454 20:52440189-52440211 CTCCGAAGAAGCTCTGTCTATGG - Intergenic
1177205980 21:18012316-18012338 CTACTGACAATCTCTATGTCAGG + Intronic
1177973337 21:27817380-27817402 CAGCTAAGACTCTCTTTGTCAGG + Intergenic
950736707 3:15014908-15014930 CTGCTTAGAATCTCTGTTTTGGG + Intronic
953090976 3:39725891-39725913 CACTTCAGCATCTCTGTGTCCGG - Intergenic
953394169 3:42553957-42553979 TTCCAAAGCATCTCTGAGTCAGG + Intronic
958854268 3:99365540-99365562 CTTTCAAGAATCTCTGTGTCTGG - Intergenic
969928534 4:10608583-10608605 TTCCTAAAAGGCTCTGTGTCTGG + Intronic
971441521 4:26692725-26692747 CTCCTAGTTATCTCTGTCTCTGG - Intronic
971909497 4:32777254-32777276 CTTCTAAGAATCTCTTAGTAAGG + Intergenic
972423579 4:38912226-38912248 CTCCATAGCTTCTCTGTGTCAGG + Intronic
975198604 4:71557011-71557033 CTACTGAGCATCTGTGTGTCAGG - Intronic
977736817 4:100426863-100426885 CTCCTAAGAATTTGAGTGTGTGG + Intronic
983441398 4:167791008-167791030 CTGATAAGAATTGCTGTGTCAGG - Intergenic
983519126 4:168688441-168688463 CTCCAAAGAATCACAATGTCAGG + Intronic
985375121 4:189327591-189327613 GTCCTGAGCATCTCTTTGTCAGG + Intergenic
985987623 5:3529971-3529993 CCCCCATGATTCTCTGTGTCTGG - Intergenic
987031842 5:13983401-13983423 CTCCAAAGAACCTTTGTGTGGGG + Intergenic
990602003 5:57368428-57368450 CTCTTAAGAATCTATTTGTATGG + Intergenic
991346538 5:65674302-65674324 CTCCAGAGATTCTCTGTGTTGGG + Intronic
994607755 5:101991670-101991692 CTCCTAAGTAGCTGGGTGTCAGG - Intergenic
996968842 5:129338785-129338807 CTCCTAATATTCTTTCTGTCTGG + Intergenic
997266657 5:132498680-132498702 GTCCTCAGAATGTCTGTGTTGGG + Intergenic
999574920 5:152965395-152965417 TTCTTCAGAATCTCTGTCTCAGG + Intergenic
1002699272 5:181111066-181111088 CTCCTCAGAATCTCAGTTTCAGG + Intergenic
1002864927 6:1112961-1112983 TTCCTAAGAGTCTTAGTGTCAGG - Intergenic
1003003752 6:2361589-2361611 CCACTGAGAATCTCTGGGTCTGG + Intergenic
1006617725 6:35341199-35341221 CTCCTAAATATCTCTGCCTCTGG - Intergenic
1008548191 6:52602435-52602457 CTCCTAAGGATCTCCTTGCCTGG + Intergenic
1012429324 6:99147751-99147773 CTCCAGAGACTCTCTGGGTCTGG - Intergenic
1017565086 6:155675179-155675201 CTGCTTACAATATCTGTGTCTGG + Intergenic
1017638531 6:156467240-156467262 CTCCTAAGGATGTCTGTGACTGG - Intergenic
1017652805 6:156598581-156598603 CTCCCAGGAATCCCTGTGTCAGG - Intergenic
1018462014 6:164007429-164007451 CTCCACAGAAGCTCTGGGTCAGG - Intergenic
1019354326 7:570886-570908 CTCCCAGCACTCTCTGTGTCGGG + Intronic
1024546741 7:50528749-50528771 TTCCTGAGAATCTCTGAGACAGG - Intronic
1024992957 7:55250786-55250808 CTCCTAAGAATCTCTGTGTCTGG - Intronic
1028205764 7:88014899-88014921 CTACTCAGAATCTCTGTGGGTGG - Intronic
1031513439 7:122675244-122675266 CTCCTTTGCATTTCTGTGTCTGG - Intronic
1032320738 7:130884351-130884373 CTCCTGAGGATTTCTGTGCCTGG - Intergenic
1032858232 7:135854594-135854616 GTACTAAGGAGCTCTGTGTCAGG + Intergenic
1034836868 7:154360466-154360488 GTCCTGAGAATTTCTCTGTCTGG - Intronic
1036220717 8:6919928-6919950 CCGCTAAGAATCTCTGGGTCAGG - Intergenic
1036371714 8:8168185-8168207 CTTCAAACAATGTCTGTGTCAGG + Intergenic
1038688563 8:29740912-29740934 CAGCTAAGAATATCTGTGCCAGG - Intergenic
1039372893 8:37004544-37004566 CTCCTCACAAGCTCTGTGCCTGG - Intergenic
1042015591 8:64306269-64306291 ATTCTAAGAATCTCTGAGTTAGG - Intergenic
1042474444 8:69231219-69231241 CTCTTAATAATCTTTGTTTCTGG - Intergenic
1045322762 8:101094570-101094592 CTCTTAAAAATCTCTGTTCCTGG - Intergenic
1048106789 8:131419689-131419711 CACCTAAGAATTGGTGTGTCTGG - Intergenic
1050396590 9:5204465-5204487 CTCCTAAAAATCTCCCTGTAGGG + Intergenic
1051158827 9:14182829-14182851 CTCTTAAGAGTCTTGGTGTCTGG + Intronic
1051408024 9:16760021-16760043 CTCGTAAGAGTTTCTGTCTCTGG - Intronic
1056104785 9:83336447-83336469 CAGCTAATATTCTCTGTGTCAGG + Intronic
1059431787 9:114254832-114254854 CTCTTAAGACTCTCACTGTCTGG + Intronic
1059511863 9:114855598-114855620 ATTCTAAGGATCTCTGTGCCAGG + Intergenic
1185691416 X:2158156-2158178 CTCCCAAGTATGTCTGTATCAGG + Intergenic
1189679563 X:43501434-43501456 CTCACAATAATCTGTGTGTCTGG + Intergenic
1190089871 X:47428281-47428303 CCCCCAAGAATCTGTGTGTTAGG - Intergenic
1192435986 X:71144215-71144237 CTCCTCAGAATGTTTATGTCAGG - Intergenic
1193271241 X:79531793-79531815 CTCCATAGCACCTCTGTGTCCGG - Intergenic
1196783492 X:119402832-119402854 CCCCTTAGAATCTCAGAGTCAGG - Intronic
1197151710 X:123227543-123227565 CCCCACAGAATATCTGTGTCTGG - Intronic
1197864921 X:131007698-131007720 CTCTTGGGAATCTCTGTTTCAGG - Intergenic
1198806504 X:140500439-140500461 CTAGTAGGAGTCTCTGTGTCAGG + Intergenic
1199850492 X:151722312-151722334 CTCCTAAGAAGGTCTGGGTTTGG - Intronic
1199867248 X:151863316-151863338 CTCATTTGAATCTTTGTGTCTGG - Intergenic
1200374631 X:155767112-155767134 CCCATAGGAATCTCTGTATCCGG - Intergenic
1201367665 Y:13226292-13226314 CTCCTAAGCATTTGTTTGTCTGG + Intergenic