ID: 1024993085

View in Genome Browser
Species Human (GRCh38)
Location 7:55251542-55251564
Sequence CCTTCCTTCTTAACTAGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024993085_1024993094 26 Left 1024993085 7:55251542-55251564 CCTGTACTAGTTAAGAAGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 101
Right 1024993094 7:55251591-55251613 ATCCCAGATATGCAGGAGGATGG No data
1024993085_1024993091 19 Left 1024993085 7:55251542-55251564 CCTGTACTAGTTAAGAAGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 101
Right 1024993091 7:55251584-55251606 GCCTGTAATCCCAGATATGCAGG 0: 3
1: 199
2: 5128
3: 92360
4: 245966
1024993085_1024993089 -9 Left 1024993085 7:55251542-55251564 CCTGTACTAGTTAAGAAGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 101
Right 1024993089 7:55251556-55251578 GAAGGAAGGGCCAGGTGCAGTGG No data
1024993085_1024993093 22 Left 1024993085 7:55251542-55251564 CCTGTACTAGTTAAGAAGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 101
Right 1024993093 7:55251587-55251609 TGTAATCCCAGATATGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024993085 Original CRISPR CCTTCCTTCTTAACTAGTAC AGG (reversed) Intronic
905360849 1:37419167-37419189 CCTTCCTTCCTGCCTAATACTGG - Intergenic
917669980 1:177264422-177264444 CACTCCTATTTAACTAGTACTGG + Intronic
918850964 1:189689641-189689663 CCTGCCCTCTTAACTTGAACAGG - Intergenic
922978756 1:229806849-229806871 CCTTCCTTGTTAACTTATACTGG - Intergenic
1063341717 10:5271504-5271526 CCATCCTTCTTTACTTTTACAGG - Intergenic
1064131221 10:12711787-12711809 CCTTCATTCTAGACTAGCACTGG - Intronic
1064181943 10:13125255-13125277 CCTTGCTTCTTCACTAGACCTGG - Intronic
1071520894 10:86330958-86330980 CCTTCCTTGCTCACTAGTCCTGG - Intronic
1074154127 10:110783349-110783371 CTTTCCTTCTGACCTAGGACTGG + Exonic
1074345204 10:112678353-112678375 CCTTCCTTATAAACAAGTAATGG + Intronic
1075710331 10:124527294-124527316 CCTTCCTTCTTCACTTTTCCAGG - Intronic
1084281670 11:68099859-68099881 CCTTCCTTCTTTAGCAGTACGGG - Intronic
1085323180 11:75587318-75587340 CCTTGATCCTTAACTAGTACTGG + Exonic
1090208812 11:124900816-124900838 CCTTCCTTCATCCCTAGTTCTGG + Intergenic
1091005071 11:131945652-131945674 CCTTTCTTCTTAACAAATACTGG - Intronic
1092045786 12:5431280-5431302 CCTTCCTTCCAAACTAGGATGGG - Intergenic
1092103709 12:5905755-5905777 CCTTCCTTCTTTTCTAGTTCTGG - Intronic
1093839470 12:23879540-23879562 CCATGCTGCTTAACTAATACAGG - Intronic
1105310767 13:19207992-19208014 CCTTCCATCTTACCAAGTAGCGG - Intergenic
1107643260 13:42466607-42466629 ACTCTCTTCTTAACTAGTAATGG - Intergenic
1107791479 13:44006411-44006433 CTTTCTTTCTTGACTTGTACTGG + Intergenic
1109548286 13:63858813-63858835 GCTTCCTTCATGAATAGTACAGG + Intergenic
1109631858 13:65060120-65060142 TTTTACTTCTTAAATAGTACAGG - Intergenic
1109842123 13:67932496-67932518 TCTAGTTTCTTAACTAGTACAGG - Intergenic
1110426777 13:75375945-75375967 TCTTCCTTCTTCTCTAGTAACGG - Intronic
1112355824 13:98674241-98674263 CCTTCCTGGTTAACTAGTCTAGG - Intergenic
1114976103 14:28101965-28101987 CCTTTCTTCTTTTCTAATACTGG + Intergenic
1118354168 14:64998108-64998130 CTTTTCTTCTCAACTAGTAAAGG - Intronic
1118962224 14:70544313-70544335 CTTTCCTTTTTAACTCTTACAGG + Intergenic
1121601320 14:95205877-95205899 CCTTCCTTCTTAACTTTTTGGGG - Intronic
1121802543 14:96786624-96786646 CCTGCCTTCCTAACTAGATCGGG - Intergenic
1123411473 15:20064374-20064396 CCTTCCTTCTTGTCCAGTATTGG + Intergenic
1123520823 15:21071493-21071515 CCTTCCTTCTTGTCCAGTATTGG + Intergenic
1126067351 15:44836300-44836322 CCTTTCATCTTAACTGGTCCTGG - Intergenic
1126518627 15:49562962-49562984 CATTCCTATTTAACTAGTACTGG + Intronic
1130383436 15:83391643-83391665 CCTTCCTTCTCACCTAAGACAGG + Intergenic
1134104387 16:11475619-11475641 CCTACCTTCCTCACCAGTACAGG + Exonic
1134638110 16:15808084-15808106 CCTTTCTTCTTTACTAGCCCAGG - Intronic
1135483041 16:22838883-22838905 CCTTCCTTTTTCACCAGTCCAGG + Intronic
1143356848 17:6336121-6336143 CCTTACTTCTTACCTATTATTGG + Intergenic
1146403756 17:32519930-32519952 CCTCCCTTCTTAACTATTTCTGG - Intronic
1150795239 17:68231408-68231430 CATTCCAACTTAACTAGTGCTGG - Intergenic
1155488767 18:26376703-26376725 CATTTCTACTCAACTAGTACTGG - Intronic
1164207772 19:23072163-23072185 CCTTCCTTCCTTCCTACTACAGG - Intergenic
1166754981 19:45185089-45185111 CCTCCCTTCTTACCTACTGCAGG - Intronic
1168586235 19:57595180-57595202 CCATCCCTCTTAACAAGTAATGG + Intergenic
925750482 2:7085977-7085999 CATTCCTATTCAACTAGTACTGG - Intergenic
926739741 2:16101455-16101477 CCTTCCTTCTTCACTAAAACAGG + Intergenic
930090146 2:47525891-47525913 CATTCCTTCTTAACTTTTGCTGG - Intronic
933351587 2:81159408-81159430 CCTTCATTCCTAACAAGTTCTGG - Intergenic
935139312 2:100338670-100338692 CCTTCCTTCTCAACTCTTTCTGG + Intergenic
941510828 2:166407194-166407216 CCTTATTTCATAAATAGTACTGG + Intronic
946455731 2:219824425-219824447 TCTTCCTTCTTCACTCCTACTGG + Intergenic
948758788 2:240177199-240177221 CCTTTCTTCTTTTCTAATACAGG + Intergenic
1168959496 20:1859131-1859153 GCTTCCTTTTTAACTAGGAGTGG + Intergenic
1169452985 20:5728148-5728170 CCTTCCTTCTCAATTAGTTTTGG + Intergenic
1185386473 22:50533824-50533846 CCTTCCTACTGAACTCCTACAGG + Intergenic
952775888 3:37046054-37046076 CCTTTCTTCTTTTCTAATACAGG + Intronic
953344787 3:42166101-42166123 CCTACCTTCTCAACTAGGTCAGG + Intronic
953636031 3:44665417-44665439 CCTTTCTTTTTACCTTGTACTGG + Intergenic
958472641 3:94540736-94540758 CTTTCCTCCCTAACTAGTATAGG - Intergenic
962044663 3:131742893-131742915 TCTTCCTTCTTTAGTAGTAAAGG - Intronic
964410902 3:156396895-156396917 CGTTTCTTCTTAATTAGGACAGG + Intronic
964909380 3:161759808-161759830 CCTTTCTTCTTATCTAATACAGG - Intergenic
965901629 3:173647703-173647725 CCTTCCTTCTTTTCTAATATAGG - Intronic
966644852 3:182233611-182233633 CCCTCCTTCTCATCTGGTACAGG + Intergenic
981912006 4:149992892-149992914 CCTTCCTTCATAATTAGACCTGG - Intergenic
983047851 4:163008071-163008093 CCTTCATTCTTAAATTGTTCCGG - Intergenic
985626214 5:989909-989931 CCTTCCTTCTTCACCAGGCCAGG + Intergenic
985925901 5:3018641-3018663 CCTTCCATCTTTTCTAATACAGG + Intergenic
991213953 5:64139737-64139759 CCTTCTTACTTAAATATTACTGG + Intergenic
994007423 5:94855322-94855344 CCTTCATTCAGAACTAGAACTGG + Intronic
994413441 5:99438659-99438681 CCTTCCTTTTTCACTTTTACTGG + Intergenic
994910608 5:105900947-105900969 CCGTCCTTCTCAACTCTTACAGG - Intergenic
995320498 5:110828239-110828261 TCTTCCTTCTTAATGAGTAAAGG + Intergenic
998059065 5:139104927-139104949 CCTTCCTTCTTCTCTAGGATTGG - Intronic
1003392309 6:5724531-5724553 CCTCCCTTCTCAACTAGTGGTGG - Intronic
1006215144 6:32435102-32435124 CCTTCCTTCTTACGTTCTACTGG - Intergenic
1007007188 6:38376088-38376110 CCTTGCTGCTTAATGAGTACAGG + Intronic
1008367987 6:50705074-50705096 CCTTCCTCCTAAGCTAGTTCTGG - Intergenic
1008749233 6:54711799-54711821 CCTTCCCTCTGAACTAGAGCTGG + Intergenic
1009472945 6:64050576-64050598 CTTTCTTTCTTTCCTAGTACTGG + Intronic
1009529785 6:64797246-64797268 CCTTACCTCTTAAAGAGTACGGG - Intronic
1010442480 6:75913312-75913334 CCTTGCTTTTCTACTAGTACTGG - Intronic
1012646457 6:101689669-101689691 TCTTCCTCCTTAACTAGATCAGG - Intronic
1015509888 6:134027935-134027957 TCTTCCTTCTTTACTATCACTGG + Intronic
1018647426 6:165961367-165961389 GCTTCCTTCTGAAGTAGGACAGG - Intronic
1020868342 7:13593956-13593978 CCTTCCTTCTTTTCTATTTCTGG + Intergenic
1021553790 7:21899433-21899455 CAGTCCTTCTTAACTGGTAAGGG + Exonic
1021757718 7:23870408-23870430 CCTTCCTTCTTTTCTACTATAGG - Intergenic
1023209062 7:37783509-37783531 CCTCCTTTCTTAACCAGAACTGG - Intronic
1023841395 7:44100534-44100556 CCTTCCTTCTGACCTAACACTGG + Intergenic
1024060467 7:45694498-45694520 CCTTTCTTCTTTTCTAATACAGG - Intronic
1024993085 7:55251542-55251564 CCTTCCTTCTTAACTAGTACAGG - Intronic
1031762136 7:125726758-125726780 CCTGACTTCTAAACTAGAACTGG + Intergenic
1034329181 7:150268390-150268412 TGTTCCTTCTTAAATAGTAAAGG - Intronic
1034668873 7:152841470-152841492 TGTTCCTTCTTAAATAGTAAAGG + Intronic
1039398781 8:37249714-37249736 CCTTCCTTGTTAAATAGAAAGGG + Intergenic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1041165645 8:55089967-55089989 CCTTCTTTATTAAATAGAACTGG + Intergenic
1042988382 8:74608830-74608852 CCTTTCTTCTTTTCTAATACAGG - Intronic
1044026625 8:87180719-87180741 CCTTCCTTCTTTTTTAGTCCAGG - Intronic
1049234056 8:141501085-141501107 CCTTCATTCTTTTCTAATACAGG - Intergenic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1052447420 9:28581083-28581105 TCTTCCTTCTTACCCACTACTGG - Intronic
1186508987 X:10116490-10116512 CCTACCTTTTTAACTGGGACTGG - Exonic
1187534344 X:20124942-20124964 CCTTCTATCTTACATAGTACTGG + Exonic
1189869024 X:45362703-45362725 CCTGCCTTCTTTTCTAGTACTGG + Intergenic
1190320490 X:49176806-49176828 CCTTCCTTCTTGACTAGCCCAGG - Intronic
1196510166 X:116499868-116499890 CCTTCCTTCTGAATAAGTAGAGG - Intergenic
1197815197 X:130491037-130491059 CCTTCTTTCTCACTTAGTACAGG + Intergenic
1198633390 X:138668336-138668358 CCCTCCCTCTTAACCACTACAGG + Intronic
1201442137 Y:14019794-14019816 TCTTCCTTCTTATCTAGAATTGG - Intergenic