ID: 1024995177

View in Genome Browser
Species Human (GRCh38)
Location 7:55268745-55268767
Sequence TCTCCTGGAGGGACTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024995177_1024995187 6 Left 1024995177 7:55268745-55268767 CCTCCAGGAGTCCCTCCAGGAGA No data
Right 1024995187 7:55268774-55268796 AGGGCCAGAGTCAGAGAAGGAGG No data
1024995177_1024995194 29 Left 1024995177 7:55268745-55268767 CCTCCAGGAGTCCCTCCAGGAGA No data
Right 1024995194 7:55268797-55268819 GGTGATAACAGAGCAGGGGTCGG No data
1024995177_1024995189 8 Left 1024995177 7:55268745-55268767 CCTCCAGGAGTCCCTCCAGGAGA No data
Right 1024995189 7:55268776-55268798 GGCCAGAGTCAGAGAAGGAGGGG No data
1024995177_1024995192 24 Left 1024995177 7:55268745-55268767 CCTCCAGGAGTCCCTCCAGGAGA No data
Right 1024995192 7:55268792-55268814 GGAGGGGTGATAACAGAGCAGGG No data
1024995177_1024995191 23 Left 1024995177 7:55268745-55268767 CCTCCAGGAGTCCCTCCAGGAGA No data
Right 1024995191 7:55268791-55268813 AGGAGGGGTGATAACAGAGCAGG No data
1024995177_1024995193 25 Left 1024995177 7:55268745-55268767 CCTCCAGGAGTCCCTCCAGGAGA No data
Right 1024995193 7:55268793-55268815 GAGGGGTGATAACAGAGCAGGGG No data
1024995177_1024995188 7 Left 1024995177 7:55268745-55268767 CCTCCAGGAGTCCCTCCAGGAGA No data
Right 1024995188 7:55268775-55268797 GGGCCAGAGTCAGAGAAGGAGGG No data
1024995177_1024995186 3 Left 1024995177 7:55268745-55268767 CCTCCAGGAGTCCCTCCAGGAGA No data
Right 1024995186 7:55268771-55268793 AGGAGGGCCAGAGTCAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024995177 Original CRISPR TCTCCTGGAGGGACTCCTGG AGG (reversed) Intergenic