ID: 1024995179

View in Genome Browser
Species Human (GRCh38)
Location 7:55268748-55268770
Sequence GCCTCTCCTGGAGGGACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024995179_1024995191 20 Left 1024995179 7:55268748-55268770 CCAGGAGTCCCTCCAGGAGAGGC No data
Right 1024995191 7:55268791-55268813 AGGAGGGGTGATAACAGAGCAGG No data
1024995179_1024995188 4 Left 1024995179 7:55268748-55268770 CCAGGAGTCCCTCCAGGAGAGGC No data
Right 1024995188 7:55268775-55268797 GGGCCAGAGTCAGAGAAGGAGGG No data
1024995179_1024995193 22 Left 1024995179 7:55268748-55268770 CCAGGAGTCCCTCCAGGAGAGGC No data
Right 1024995193 7:55268793-55268815 GAGGGGTGATAACAGAGCAGGGG No data
1024995179_1024995186 0 Left 1024995179 7:55268748-55268770 CCAGGAGTCCCTCCAGGAGAGGC No data
Right 1024995186 7:55268771-55268793 AGGAGGGCCAGAGTCAGAGAAGG No data
1024995179_1024995189 5 Left 1024995179 7:55268748-55268770 CCAGGAGTCCCTCCAGGAGAGGC No data
Right 1024995189 7:55268776-55268798 GGCCAGAGTCAGAGAAGGAGGGG No data
1024995179_1024995192 21 Left 1024995179 7:55268748-55268770 CCAGGAGTCCCTCCAGGAGAGGC No data
Right 1024995192 7:55268792-55268814 GGAGGGGTGATAACAGAGCAGGG No data
1024995179_1024995187 3 Left 1024995179 7:55268748-55268770 CCAGGAGTCCCTCCAGGAGAGGC No data
Right 1024995187 7:55268774-55268796 AGGGCCAGAGTCAGAGAAGGAGG No data
1024995179_1024995194 26 Left 1024995179 7:55268748-55268770 CCAGGAGTCCCTCCAGGAGAGGC No data
Right 1024995194 7:55268797-55268819 GGTGATAACAGAGCAGGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024995179 Original CRISPR GCCTCTCCTGGAGGGACTCC TGG (reversed) Intergenic