ID: 1024995183

View in Genome Browser
Species Human (GRCh38)
Location 7:55268756-55268778
Sequence GCCCTCCTGCCTCTCCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024995183_1024995186 -8 Left 1024995183 7:55268756-55268778 CCCTCCAGGAGAGGCAGGAGGGC No data
Right 1024995186 7:55268771-55268793 AGGAGGGCCAGAGTCAGAGAAGG No data
1024995183_1024995191 12 Left 1024995183 7:55268756-55268778 CCCTCCAGGAGAGGCAGGAGGGC No data
Right 1024995191 7:55268791-55268813 AGGAGGGGTGATAACAGAGCAGG No data
1024995183_1024995189 -3 Left 1024995183 7:55268756-55268778 CCCTCCAGGAGAGGCAGGAGGGC No data
Right 1024995189 7:55268776-55268798 GGCCAGAGTCAGAGAAGGAGGGG No data
1024995183_1024995196 28 Left 1024995183 7:55268756-55268778 CCCTCCAGGAGAGGCAGGAGGGC No data
Right 1024995196 7:55268807-55268829 GAGCAGGGGTCGGAGAGGACAGG No data
1024995183_1024995188 -4 Left 1024995183 7:55268756-55268778 CCCTCCAGGAGAGGCAGGAGGGC No data
Right 1024995188 7:55268775-55268797 GGGCCAGAGTCAGAGAAGGAGGG No data
1024995183_1024995194 18 Left 1024995183 7:55268756-55268778 CCCTCCAGGAGAGGCAGGAGGGC No data
Right 1024995194 7:55268797-55268819 GGTGATAACAGAGCAGGGGTCGG No data
1024995183_1024995193 14 Left 1024995183 7:55268756-55268778 CCCTCCAGGAGAGGCAGGAGGGC No data
Right 1024995193 7:55268793-55268815 GAGGGGTGATAACAGAGCAGGGG No data
1024995183_1024995195 23 Left 1024995183 7:55268756-55268778 CCCTCCAGGAGAGGCAGGAGGGC No data
Right 1024995195 7:55268802-55268824 TAACAGAGCAGGGGTCGGAGAGG No data
1024995183_1024995187 -5 Left 1024995183 7:55268756-55268778 CCCTCCAGGAGAGGCAGGAGGGC No data
Right 1024995187 7:55268774-55268796 AGGGCCAGAGTCAGAGAAGGAGG No data
1024995183_1024995192 13 Left 1024995183 7:55268756-55268778 CCCTCCAGGAGAGGCAGGAGGGC No data
Right 1024995192 7:55268792-55268814 GGAGGGGTGATAACAGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024995183 Original CRISPR GCCCTCCTGCCTCTCCTGGA GGG (reversed) Intergenic