ID: 1024995187

View in Genome Browser
Species Human (GRCh38)
Location 7:55268774-55268796
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024995176_1024995187 7 Left 1024995176 7:55268744-55268766 CCCTCCAGGAGTCCCTCCAGGAG No data
Right 1024995187 7:55268774-55268796 AGGGCCAGAGTCAGAGAAGGAGG No data
1024995177_1024995187 6 Left 1024995177 7:55268745-55268767 CCTCCAGGAGTCCCTCCAGGAGA No data
Right 1024995187 7:55268774-55268796 AGGGCCAGAGTCAGAGAAGGAGG No data
1024995184_1024995187 -6 Left 1024995184 7:55268757-55268779 CCTCCAGGAGAGGCAGGAGGGCC No data
Right 1024995187 7:55268774-55268796 AGGGCCAGAGTCAGAGAAGGAGG No data
1024995185_1024995187 -9 Left 1024995185 7:55268760-55268782 CCAGGAGAGGCAGGAGGGCCAGA No data
Right 1024995187 7:55268774-55268796 AGGGCCAGAGTCAGAGAAGGAGG No data
1024995179_1024995187 3 Left 1024995179 7:55268748-55268770 CCAGGAGTCCCTCCAGGAGAGGC No data
Right 1024995187 7:55268774-55268796 AGGGCCAGAGTCAGAGAAGGAGG No data
1024995183_1024995187 -5 Left 1024995183 7:55268756-55268778 CCCTCCAGGAGAGGCAGGAGGGC No data
Right 1024995187 7:55268774-55268796 AGGGCCAGAGTCAGAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024995187 Original CRISPR AGGGCCAGAGTCAGAGAAGG AGG Intergenic