ID: 1024995190

View in Genome Browser
Species Human (GRCh38)
Location 7:55268778-55268800
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024995190_1024995191 -10 Left 1024995190 7:55268778-55268800 CCAGAGTCAGAGAAGGAGGGGTG No data
Right 1024995191 7:55268791-55268813 AGGAGGGGTGATAACAGAGCAGG No data
1024995190_1024995192 -9 Left 1024995190 7:55268778-55268800 CCAGAGTCAGAGAAGGAGGGGTG No data
Right 1024995192 7:55268792-55268814 GGAGGGGTGATAACAGAGCAGGG No data
1024995190_1024995196 6 Left 1024995190 7:55268778-55268800 CCAGAGTCAGAGAAGGAGGGGTG No data
Right 1024995196 7:55268807-55268829 GAGCAGGGGTCGGAGAGGACAGG No data
1024995190_1024995195 1 Left 1024995190 7:55268778-55268800 CCAGAGTCAGAGAAGGAGGGGTG No data
Right 1024995195 7:55268802-55268824 TAACAGAGCAGGGGTCGGAGAGG No data
1024995190_1024995194 -4 Left 1024995190 7:55268778-55268800 CCAGAGTCAGAGAAGGAGGGGTG No data
Right 1024995194 7:55268797-55268819 GGTGATAACAGAGCAGGGGTCGG No data
1024995190_1024995197 28 Left 1024995190 7:55268778-55268800 CCAGAGTCAGAGAAGGAGGGGTG No data
Right 1024995197 7:55268829-55268851 GAGAGAGATGCCAACCGACCTGG No data
1024995190_1024995193 -8 Left 1024995190 7:55268778-55268800 CCAGAGTCAGAGAAGGAGGGGTG No data
Right 1024995193 7:55268793-55268815 GAGGGGTGATAACAGAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024995190 Original CRISPR CACCCCTCCTTCTCTGACTC TGG (reversed) Intergenic