ID: 1024995191

View in Genome Browser
Species Human (GRCh38)
Location 7:55268791-55268813
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024995190_1024995191 -10 Left 1024995190 7:55268778-55268800 CCAGAGTCAGAGAAGGAGGGGTG No data
Right 1024995191 7:55268791-55268813 AGGAGGGGTGATAACAGAGCAGG No data
1024995184_1024995191 11 Left 1024995184 7:55268757-55268779 CCTCCAGGAGAGGCAGGAGGGCC No data
Right 1024995191 7:55268791-55268813 AGGAGGGGTGATAACAGAGCAGG No data
1024995179_1024995191 20 Left 1024995179 7:55268748-55268770 CCAGGAGTCCCTCCAGGAGAGGC No data
Right 1024995191 7:55268791-55268813 AGGAGGGGTGATAACAGAGCAGG No data
1024995176_1024995191 24 Left 1024995176 7:55268744-55268766 CCCTCCAGGAGTCCCTCCAGGAG No data
Right 1024995191 7:55268791-55268813 AGGAGGGGTGATAACAGAGCAGG No data
1024995177_1024995191 23 Left 1024995177 7:55268745-55268767 CCTCCAGGAGTCCCTCCAGGAGA No data
Right 1024995191 7:55268791-55268813 AGGAGGGGTGATAACAGAGCAGG No data
1024995183_1024995191 12 Left 1024995183 7:55268756-55268778 CCCTCCAGGAGAGGCAGGAGGGC No data
Right 1024995191 7:55268791-55268813 AGGAGGGGTGATAACAGAGCAGG No data
1024995185_1024995191 8 Left 1024995185 7:55268760-55268782 CCAGGAGAGGCAGGAGGGCCAGA No data
Right 1024995191 7:55268791-55268813 AGGAGGGGTGATAACAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024995191 Original CRISPR AGGAGGGGTGATAACAGAGC AGG Intergenic
No off target data available for this crispr