ID: 1024995196

View in Genome Browser
Species Human (GRCh38)
Location 7:55268807-55268829
Sequence GAGCAGGGGTCGGAGAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024995190_1024995196 6 Left 1024995190 7:55268778-55268800 CCAGAGTCAGAGAAGGAGGGGTG No data
Right 1024995196 7:55268807-55268829 GAGCAGGGGTCGGAGAGGACAGG No data
1024995185_1024995196 24 Left 1024995185 7:55268760-55268782 CCAGGAGAGGCAGGAGGGCCAGA No data
Right 1024995196 7:55268807-55268829 GAGCAGGGGTCGGAGAGGACAGG No data
1024995183_1024995196 28 Left 1024995183 7:55268756-55268778 CCCTCCAGGAGAGGCAGGAGGGC No data
Right 1024995196 7:55268807-55268829 GAGCAGGGGTCGGAGAGGACAGG No data
1024995184_1024995196 27 Left 1024995184 7:55268757-55268779 CCTCCAGGAGAGGCAGGAGGGCC No data
Right 1024995196 7:55268807-55268829 GAGCAGGGGTCGGAGAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024995196 Original CRISPR GAGCAGGGGTCGGAGAGGAC AGG Intergenic