ID: 1024995305

View in Genome Browser
Species Human (GRCh38)
Location 7:55269656-55269678
Sequence CTGAGTACACAAATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024995303_1024995305 -7 Left 1024995303 7:55269640-55269662 CCGAGCACTTCGGAGACTGAGTA No data
Right 1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024995305 Original CRISPR CTGAGTACACAAATGGACAA TGG Intergenic
No off target data available for this crispr