ID: 1024996695

View in Genome Browser
Species Human (GRCh38)
Location 7:55278046-55278068
Sequence GGACCCGGCCACAGAGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024996695_1024996700 -9 Left 1024996695 7:55278046-55278068 CCAGTCCCTCTGTGGCCGGGTCC No data
Right 1024996700 7:55278060-55278082 GCCGGGTCCTGGCCACGTGGTGG No data
1024996695_1024996706 21 Left 1024996695 7:55278046-55278068 CCAGTCCCTCTGTGGCCGGGTCC No data
Right 1024996706 7:55278090-55278112 CTACTCACTGAAATACTGATGGG No data
1024996695_1024996707 22 Left 1024996695 7:55278046-55278068 CCAGTCCCTCTGTGGCCGGGTCC No data
Right 1024996707 7:55278091-55278113 TACTCACTGAAATACTGATGGGG No data
1024996695_1024996705 20 Left 1024996695 7:55278046-55278068 CCAGTCCCTCTGTGGCCGGGTCC No data
Right 1024996705 7:55278089-55278111 GCTACTCACTGAAATACTGATGG No data
1024996695_1024996702 -8 Left 1024996695 7:55278046-55278068 CCAGTCCCTCTGTGGCCGGGTCC No data
Right 1024996702 7:55278061-55278083 CCGGGTCCTGGCCACGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024996695 Original CRISPR GGACCCGGCCACAGAGGGAC TGG (reversed) Intergenic
No off target data available for this crispr