ID: 1024998604

View in Genome Browser
Species Human (GRCh38)
Location 7:55295208-55295230
Sequence GAGGGTGAACTGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2473
Summary {0: 4, 1: 175, 2: 458, 3: 742, 4: 1094}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024998604 Original CRISPR GAGGGTGAACTGAAGCAGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr