ID: 1025000839

View in Genome Browser
Species Human (GRCh38)
Location 7:55313294-55313316
Sequence GAGAGAAATTGCAGCACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025000839_1025000843 17 Left 1025000839 7:55313294-55313316 CCAGGGGTGCTGCAATTTCTCTC No data
Right 1025000843 7:55313334-55313356 GGTGTCAGAGCATCTGCAGCTGG No data
1025000839_1025000844 24 Left 1025000839 7:55313294-55313316 CCAGGGGTGCTGCAATTTCTCTC No data
Right 1025000844 7:55313341-55313363 GAGCATCTGCAGCTGGATCTAGG No data
1025000839_1025000840 -4 Left 1025000839 7:55313294-55313316 CCAGGGGTGCTGCAATTTCTCTC No data
Right 1025000840 7:55313313-55313335 TCTCTGTGCCCATTTAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025000839 Original CRISPR GAGAGAAATTGCAGCACCCC TGG (reversed) Intergenic
No off target data available for this crispr