ID: 1025002742

View in Genome Browser
Species Human (GRCh38)
Location 7:55331123-55331145
Sequence GAGTGGGAGGGGAGGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025002742_1025002754 22 Left 1025002742 7:55331123-55331145 CCAACTTCCCTCCCCTCCCACTC No data
Right 1025002754 7:55331168-55331190 CTTCCCCTTGACCAACCCTTTGG No data
1025002742_1025002755 23 Left 1025002742 7:55331123-55331145 CCAACTTCCCTCCCCTCCCACTC No data
Right 1025002755 7:55331169-55331191 TTCCCCTTGACCAACCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025002742 Original CRISPR GAGTGGGAGGGGAGGGAAGT TGG (reversed) Intergenic
No off target data available for this crispr