ID: 1025006614

View in Genome Browser
Species Human (GRCh38)
Location 7:55360563-55360585
Sequence TCCTGTCTATATGGTCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025006601_1025006614 30 Left 1025006601 7:55360510-55360532 CCTCCATGTCTGGACCAAGAGGG No data
Right 1025006614 7:55360563-55360585 TCCTGTCTATATGGTCCAGCTGG No data
1025006603_1025006614 27 Left 1025006603 7:55360513-55360535 CCATGTCTGGACCAAGAGGGTGG No data
Right 1025006614 7:55360563-55360585 TCCTGTCTATATGGTCCAGCTGG No data
1025006607_1025006614 16 Left 1025006607 7:55360524-55360546 CCAAGAGGGTGGGGCTCTGAGTG No data
Right 1025006614 7:55360563-55360585 TCCTGTCTATATGGTCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025006614 Original CRISPR TCCTGTCTATATGGTCCAGC TGG Intergenic