ID: 1025010789

View in Genome Browser
Species Human (GRCh38)
Location 7:55396374-55396396
Sequence CACCGGAGCCTCTCCTGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025010785_1025010789 0 Left 1025010785 7:55396351-55396373 CCTGCCCTCTGGAGAAATTGCTT 0: 1
1: 0
2: 1
3: 28
4: 219
Right 1025010789 7:55396374-55396396 CACCGGAGCCTCTCCTGCAAAGG No data
1025010787_1025010789 -5 Left 1025010787 7:55396356-55396378 CCTCTGGAGAAATTGCTTCACCG No data
Right 1025010789 7:55396374-55396396 CACCGGAGCCTCTCCTGCAAAGG No data
1025010781_1025010789 28 Left 1025010781 7:55396323-55396345 CCATCAGAGCCTTCAGTTCTTGA No data
Right 1025010789 7:55396374-55396396 CACCGGAGCCTCTCCTGCAAAGG No data
1025010782_1025010789 19 Left 1025010782 7:55396332-55396354 CCTTCAGTTCTTGACAAGCCCTG 0: 1
1: 0
2: 1
3: 17
4: 194
Right 1025010789 7:55396374-55396396 CACCGGAGCCTCTCCTGCAAAGG No data
1025010786_1025010789 -4 Left 1025010786 7:55396355-55396377 CCCTCTGGAGAAATTGCTTCACC 0: 1
1: 0
2: 3
3: 14
4: 207
Right 1025010789 7:55396374-55396396 CACCGGAGCCTCTCCTGCAAAGG No data
1025010784_1025010789 1 Left 1025010784 7:55396350-55396372 CCCTGCCCTCTGGAGAAATTGCT 0: 1
1: 0
2: 2
3: 17
4: 264
Right 1025010789 7:55396374-55396396 CACCGGAGCCTCTCCTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025010789 Original CRISPR CACCGGAGCCTCTCCTGCAA AGG Intronic